Em formação

Complexidade na criação de animais transgênicos (por exemplo, camundongos)


Muitos artigos que vi descrevendo modelos de roedores transgênicos (e presumivelmente aplicáveis ​​a outros organismos modelo) envolvem o knock-in, ou modificação de, um único gene, possivelmente dois genes. Com relação às técnicas de recombinação, o que impede o direcionamento de vários genes em um único organismo? Por exemplo, se eu quisesse simultaneamente nocautear alguns genes e nocautear outros no mesmo camundongo, seria forçado a gerar linhagens transgênicas modificadas individualmente e, em seguida, fazer alguns cruzamentos "sofisticados" para gerar os camundongos modificados múltiplos?


Um dos motivos é a baixa probabilidade de sucesso. A modificação de um gene quase sempre envolve um evento de recombinação do DNA do plasmídeo com um local-alvo no genoma (e digo quase apenas porque pode haver algum método que eu não conheço, mas todos os que estou familiarizado fazem) . A probabilidade disso diminui exponencialmente com o número de genes que você está tentando modificar. Se você está tentando fazer vários mutantes de genes individuais, a probabilidade de sucesso diminui apenas linearmente.

Outra razão é ter mais conhecimento e poder experimental. Você pode aprender pouco com um mutante duplo se também não tiver os mutantes individuais para comparar. Na verdade, a maioria dos revisores solicitaria dados mutantes individuais se você fez um mutante duplo em seu artigo. Isso é especialmente verdadeiro com moscas e vermes, pois as cruzes levam menos tempo com eles.

Além disso, quanto mais genes mutantes você tiver, mais fraco será o animal. Seus mutantes podem não ser viáveis ​​com muitas mutações.


Você pode introduzir vários transgenes em sua linha de células embrionárias antes de injetá-los no blastocisto. Dessa forma, você não precisa fazer isso individualmente um por um e depois reproduzi-los todos juntos, o que pode exigir muitos recursos. Isso é especialmente necessário quando seus genes estão realmente próximos (ligação genética) e, portanto, não se reproduzem em uma proporção Mendeliana. De qualquer forma, cada gene que você tenta modificar geralmente leva pelo menos alguns meses. Eu acho que o CRISPR o tornou mais rápido, mas ainda é muito blotting em gel para garantir que você gerou o transgene.


Expansão hereditária do código genético em camundongos e peixes-zebra

O código genético pode ser expandido para codificar aminoácidos não naturais (Uaas) pela introdução de um par ortogonal de tRNA / aminoacil-tRNA sintetase (aaRS) para decodificar um códon de parada. Desenvolvido inicialmente em Escherichia coli 1, esta estratégia tem se mostrado geralmente aplicável em células eucarióticas 2 e na geração de invertebrados transgênicos capazes de incorporação de Uaa, incluindo Caenorhabditis elegans 3 e Drosophila melanogaster 4 Embora células e tecidos de camundongo possam ser transduzidos transitoriamente para incorporar Uaas 5, permanece desconhecido se vertebrados transgênicos com um código genético expandido hereditário em todo o sistema podem ser gerados, pois não está claro se a complexidade biológica dos vertebrados permite a introdução, manutenção e transmissão do material genético recém-introduzido para expansão do código. Aqui, relatamos pela primeira vez a geração de camundongos transgênicos e peixes-zebra com um código genético expandido, fornecendo modelos de animais vertebrados valiosos para pesquisas biológicas e biomédicas.

Rato de laboratório (Mus musculus) é um modelo de mamífero amplamente utilizado para estudos de desenvolvimento, fisiológicos e patológicos devido à sua alta homologia genética com humanos. Decidimos integrar o tRNA ortogonalCUA/ Par AzFRS, que pode decodificar o códon de parada âmbar UAG como o Uaa p-azido-fenilalanina (AzF) 6, no genoma do camundongo. Um construto contendo AzFRS marcado com FLAG conduzido pelo promotor do fator de alongamento humano 1 alfa (EF1α) seguido por quatro cópias do tRNA conduzido pelo promotor U6 foi selecionado após otimização da eficiência de incorporação de AzF em células de mamíferos (Figura 1A). Este RS (tRNA) a construção foi linearizada e diretamente entregue nos núcleos de 190 zigotos de camundongos, produzindo 36 filhotes F0, quatro dos quais mostraram resultados de genotipagem positivos (informações suplementares, Figura S1A). RT-PCR revelou a presença de mRNA de AzFRS em fibroblastos da ponta da cauda isolados de dois fundadores, F0-1 e F0-10 (informações suplementares, Figura S1B). A colônia F0-1 foi mantida por retrocruzamentos sucessivos com camundongos WT C57BL / 6. A prole resultante era viável e indistinguível dos irmãos WT e, em geral, esse cruzamento produziu tamanhos normais de ninhada junto com um padrão de herança Mendeliano. O RS (tRNA) gene foi transmitido de forma eficiente para as gerações subsequentes (F1, F2 e F3 Suplementar informações, Tabela S1A). Em média, 15 cópias de transgenes foram detectadas em um camundongo F2, conforme determinado por qPCR usando GAPDH como controle interno (informações suplementares, Tabela S1B), indicando que o transgene foi integrado ao genoma F0 e transmitido de forma estável. A expressão de proteínas AzFRS foi detectada em vários tecidos em camundongos F2 por western blotting (Figura 1B).

Geração e caracterização de camundongos transgênicos e peixes-zebra com código genético expandido. (UMA) Diagrama esquemático da construção usada para gerar camundongos transgênicos e a construção repórter. A construção do transgene contém AzFRS e quatro cópias (4 ×) de Bacillus stearothermophilus (Bst) -tRNACUA. pA, sinal de poliadenilação. O construto repórter eGFP-TAG-mCherry foi gerado pela inserção de um códon de parada âmbar (TAG) entre eGFP e mCherry genes. Verificado em células HEK293T e fibroblastos embrionários de camundongo (MEF), este repórter expressa mCherry apenas quando tRNACUA, AzF-RS e AzF estão todos disponíveis para as células. (B) Análise de Western blot das amostras de tecido indicadas de RS transgênico (tRNA) camundongos da geração F2 e descendentes. A seta indica a banda imunorreativa de AzFRS-FLAG detectada por um anticorpo anti-FLAG. GAPDH atua como um controle de carregamento interno. (C) Análise de RNA-seq de tecidos hepáticos isolados de RS transgênica WT e F2 de 6 semanas de idade (tRNA) camundongos. O gráfico mostra fragmentos do transcriptoma inteiro por quilobase de exon por milhão de fragmentos mapeados (FPKM). Significativamente (P & lt mudança de 0,05 vezes & gt 2) genes regulados para cima e para baixo nos camundongos transgênicos de três réplicas biológicas são coloridos em vermelho e azul, respectivamente, outros genes estão em preto. (D-F) TRNA ortogonal integrado ao genomaCUA/ AzFRS, incorporação de AzF direcionada por par em resposta ao códon âmbar em células primárias isoladas de camundongos transgênicos da geração F2-F3. Imagens representativas são mostradas para células neuronais primárias (D), células da medula óssea (E) e fibroblastos (F) transduzida com lentivírus carregando o gene repórter eGFP-amb-mCherry na presença ou ausência de AzF 1 mM. Barra de escala: 100 μm pol. D e F 20 μm em E. (G) Diagrama esquemático da construção usada para gerar peixes-zebra transgênicos e a construção repórter. A construção do transgene contém um tRNA ortogonalCUA/ AzFRS par, SVEpA (SV40 sinal de poliadenilação precoce), SVLpA (SV40 sinal de poliadenilação tardio), γCRY (promotor xenopus γ-cristalina), U6 (promotor humano U6 pol III), INS (isolador de camundongo SP-10) e ubi (peixe-zebra promotor da ubiquitina). (H) Análise de Western blot da expressão de AzFRS-FLAG em embriões ou tecidos adultos da nadadeira caudal na geração F2 usando um anticorpo anti-FLAG (indicado por uma seta). O anticorpo FLAG também detecta uma banda não específica, migrando mais lentamente do que a banda AzFRS marcada. (EU-K) Incorporação de AzF no repórter eGFP no peixe-zebra transgênico na Vivo. Embriões em estágio de 1 célula de gerações F2-F3 de peixes-zebra transgênicos foram injetados com o mRNA que codifica o repórter mCherry-eGFP (Y145amb). Os embriões foram incubados em água com ou sem 2,5 mM de AzF por 24 h. A incorporação de AzF no local do códon âmbar permite a expressão de eGFP de comprimento total no núcleo. As imagens de fluorescência de embriões inteiros (EU)e mesenquimal (J) e notocord (K) tecidos são mostrados. As setas indicam células com incorporação de AzF. Barras de escala: 50 μm.

Em seguida, avaliamos o impacto potencial da integração gênica nos camundongos vivos. Camundongos transgênicos F2 e descendentes foram usados ​​na caracterização subsequente. Através da análise histológica, não foram observadas diferenças morfológicas detectáveis ​​entre os camundongos transgênicos e os controles da ninhada dos tecidos analisados, incluindo cérebro, coração, fígado, cólon, rim, músculo esquelético e pulmão (informações suplementares, Figura S1C). Para avaliar ainda mais os efeitos do transgene na expressão gênica, usamos RNA-seq para analisar os transcriptomas do tecido hepático, onde AzFRS apresentou a maior expressão (Figura 1B). Em comparação com os camundongos WT, identificamos pequenas alterações em 97 transcrições reguladas positivamente e 47 reguladas negativamente (P & lt mudança de 0,05 vezes & gt 2) no RS (tRNA) camundongos transgênicos (Figura 1C). Entre esses genes específicos do fígado, os genes regulados positivamente caíram em uma variedade de categorias relacionadas ao metabolismo (informações suplementares, Figura S1D). Entre os genes regulados para baixo, houve um ligeiro enriquecimento de enzimas metabólicas primárias associadas aos processos de sinalização da insulina, sugerindo que o transgene pode ter um efeito repressivo no metabolismo primário no fígado. Para testar se essas pequenas alterações de expressão prejudicaram a função hepática na linha transgênica, medimos os índices químicos do sangue (informações suplementares, Figura S1E). Nenhuma diferença significativa foi observada entre WT e camundongos transgênicos nos níveis de aspartato transaminase (AST), alanina transaminase (ALT), albumina e outros índices. Além disso, alimentamos os camundongos transgênicos com ou sem 30 mg / ml de AzF por 10 dias, e nenhum defeito óbvio (dados não mostrados) e anormalidades nos índices químicos do sangue foram observados (informações suplementares, Figura S1F). Tomados em conjunto, esses resultados demonstram que a integração do genoma de RS (tRNA) gene em camundongos não causou prejuízo fisiológico significativo.

Para avaliar funcionalmente o tRNA integradoCUA/ Par de AzFRS, experimentos de incorporação de AzF foram realizados em células primárias derivadas de camundongos transgênicos adultos com transdução de um repórter eGFP-amb-mCherry, no qual eGFP é fundido a mCherry ligado pelo códon de parada âmbar 7 (Figura 1A). Neuroesferas isoladas da zona subventricular de camundongos transgênicos foram induzidas a se diferenciar em neurônios e simultaneamente transduzidas com o lentivírus carregando o repórter eGFP-amb-mCherry (Figura 1D). A fluorescência do eGFP apareceu entre o dia 4 e o dia 5 após a transdução e diferenciação, indicando o sucesso da transdução dos neurônios. Embora tenhamos detectado eGFP em neurônios com ou sem AzF, os sinais de mCherry co-localizados com eGFP foram detectados apenas na presença de AzF. Além disso, através da infecção com o repórter eGFP-amb-mCherry e adição de AzF, a supressão âmbar também foi detectada em células da medula óssea primária de camundongos transgênicos (Figura 1E), mas surpreendentemente ausente em fibroblastos (Figura 1F e informações suplementares, Figura S1G). No entanto, quando co-transfectamos tRNA adicionalCUA com o repórter eGFP-amb-mCherry em fibroblastos derivados de camundongos transgênicos, a incorporação de AzF foi detectada (dados não mostrados), sugerindo que AzFRS era funcional e tRNACUA a expressão pode ser limitada em fibroblastos. Tomados em conjunto, esses dados demonstram a expressão bem-sucedida de tRNA funcionalCUA/ AzFRS em células primárias isoladas de camundongos transgênicos, que direciona a incorporação de AzF no repórter em resposta ao códon de parada âmbar. A incorporação de AzF era dependente do tipo de célula, em parte influenciada pela quantidade de tRNACUA expresso.

Também procuramos expandir o código genético no peixe-zebra (Danio rerio), que é um modelo de vertebrado popular para imagens ao vivo e compartilha muitos mecanismos moleculares e celulares conservados com mamíferos. Uma construção para a expressão ubíqua de tRNACUA/ AzFRS (Figura 1G) foi co-injetado com o mRNA da transposase Tol2 em embriões de peixe-zebra no estágio 8 de 1 ou 2 células para gerar os peixes transgênicos. A expressão de AzFRS foi detectada por meio de sua tag FLAG C-terminal em ambas as larvas (2 dias após a fertilização (dpf)) e nadadeira caudal adulta na geração F2 (Figura 1H), revelando o sucesso e integração estável do transgene. Para avaliar a incorporação AzF na Vivo, usamos uma codificação de mRNA para um repórter eGFP direcionado a nuclear, em que um códon de parada âmbar é inserido na posição de eGFP-Y145 e a sequência de codificação mCherry (como um controle de tradução) seguido por um "autoclivagem" 2A peptídeo é fundido ao N-terminal de eGFP (Figura 1G). Em vitro-transcrito mCherry-eGFP (Y145amb) mRNA foi injetado no embrião de peixe transgênico F2 no estágio de 1 célula, e os embriões foram incubados em água contendo 2,5 mM de AzF, uma concentração que não causa toxicidade detectável conforme determinado em embriões WT e de peixe-zebra transgênico (Suplementar informações, Figura S2A). Na presença de AzF, houve um aumento significativo no número de células com sinais de eGFP 24 horas após a fertilização (hpf), indicando supressão do códon de parada âmbar (Figura 1I e Informações suplementares, Figura S2B). Imagens com maior ampliação mostraram que o sinal de eGFP no núcleo pode ser observado em todos os tipos de células analisadas, ou seja, células mesenquimais, notocórdio e musculares (Figura 1J e 1K e informações suplementares, Figura S2C).

Em conclusão, mostramos que, integrando um par tRNA / aaRS ortogonal no genoma, um código genético expandido pode ser estabelecido e herdado em duas espécies de vertebrados, camundongo e peixe-zebra. Este trabalho demonstra, portanto, o sucesso da expansão do código em seres vivos de uma complexidade biológica superior ao relatado, sugerindo uma maleabilidade inesperadamente alta do código genético. De notar, estes modelos de vertebrados podem ser equipados com Uaas de propriedades químicas, físicas e biológicas adaptadas, por exemplo, Uaas sensíveis à luz para optogenética 9 e Uaas bio-reativos para no local química 10, o que facilitaria muito suas aplicações na pesquisa biológica. Incorporação Uaa na Vivo tem o potencial de impactar os estudos de desenvolvimento e comportamento por meio da sondagem precisa e manipulação de proteínas-alvo em seu habitat nativo. Além disso, com células incorporadas de Uaa, tecidos e animais inteiros derivados do mesmo animal transgênico, agora se torna possível correlacionar resultados habilitados para incorporação de Uaa de células individuais a órgãos e o organismo intacto de uma maneira coesa. Outras investigações da tolerância do hospedeiro à expansão do código 11, integração específica do local do transgene via edição do genoma e respostas dependentes de tecido guiarão a otimização dos componentes introduzidos, levando a uma maior eficiência da codificação Uaa e extensão da estratégia para outro tRNA / aaRS pares e vertebrados.


RATOS TRANSGÊNICOS

Para gerar camundongos transgênicos, o cDNA de interesse é ligado a um promotor (e uma cauda poliA), que muitas vezes é específico do pulmão, e o DNA ou "transgene" é microinjetado em pró-núcleos de ovos fertilizados para integrar aleatoriamente o material genético no genoma 2. Após a colocação dos ovos no oviduto, a prole pode então expressar o transgene. Desenvolvimentos mais recentes permitem expressão condicional (específica da célula) e induzível. A expressão induzível evita a expressão de desenvolvimento do transgene. Isso é particularmente importante no estudo da DPOC, para evitar confusão entre destruição e aumento dos espaços aéreos que definem o enfisema, e espaços aéreos aumentados devido à falha na septação, prejudicando a alveogênese durante o desenvolvimento pulmonar (fig. 1 ⇓). Promotores específicos de linhagem (ou tecnologia knock-in) ligados a marcadores de cores que marcam grupos específicos de células também podem ser usados. Essas técnicas se tornarão muito úteis na identificação de células-tronco específicas no futuro.

Camundongos transgênicos têm sido usados ​​na DPOC para superexpressar um determinado produto gênico para obter um fenótipo da DPOC, geralmente o aumento do espaço aéreo. Portanto, essa técnica permitirá a dedução de que “se” esse gene específico for expresso em níveis elevados, ele “pode” levar a aspectos da DPOC. Se for sabido que a proteína está de fato elevada na DPOC, isso fornece fortes evidências de que ela contribui para a patologia. Existem agora muitos exemplos na literatura de camundongos transgênicos que contribuíram para a compreensão da DPOC.

Uma das primeiras aplicações da tecnologia transgênica para a DPOC foi a superexpressão de colagenase-1 (matriz metaloproteinase (MMP) -1) resultando no aumento do espaço aéreo 3. Isso desafiou a hipótese elastase-antielastase, colocando assim o colágeno diretamente na imagem. Uma limitação do estudo 3 é que, embora a expressão fosse específica para o pulmão em algumas linhas (apesar de ser conduzida pelo promotor da haptoglobina), ela não era induzível. No entanto, os autores não detectaram expressão de colagenase em algumas linhas durante o desenvolvimento inicial. O papel do colágeno na DPOC é complexo. Claramente, a destruição de uma unidade alveolar requer a perda de todas as células e da matriz extracelular, incluindo colágeno, no entanto, o conteúdo de colágeno total na DPOC está realmente aumentado, com fibrose submucosa das vias aéreas provavelmente contribuindo para a obstrução do fluxo de ar. Polimorfismos no promotor da colagenase que causam níveis mais altos de expressão de colagenase, na verdade, correlacionados com a proteção contra o declínio no volume expiratório forçado em um segundo na grande população de estudo de saúde pulmonar 4. No entanto, os camundongos não possuem MMP-1, mas expressam as duas outras MMP colagenases (MMP-8, neutrófilos colagenase ou colagenase-2 e MMP-13 colagenase-3), que compensam a falta de colagenase-1 em roedores.

A superexpressão de interleucina (IL) -13 5 e interferon (IFN) -γ 6 representam dois exemplos importantes de transgenes condicionais induzíveis que levam ao enfisema em camundongos adultos. A superexpressão da citocina IL-13 da célula T auxiliar (Th) 2 resultou em inflamação e destruição pulmonar que era dependente de metalo- (MMP-9 e MMP-12) e cisteína-proteinase. Esses camundongos também apresentam remodelação das vias aéreas com hipertrofia de células caliciformes e deposição de colágeno subepitelial. A ativação do fator de crescimento transformador (TGF) -β mediada por MMP-9 foi responsável pela remodelação do colágeno neste modelo 7. Se a IL-13 está superexpressada na DPOC humana está atualmente sob investigação. Este mouse também apóia a “hipótese holandesa”, que afirma que a asma e a DPOC têm mecanismos subjacentes comuns. A superexpressão da citocina Th1 IFN-γ também resultou em inflamação e enfisema dependente de proteinase.Em comparação com o camundongo transgênico IL-13, o componente inflamatório com IFN-γ foi mais sutil, a apoptose foi proeminente e não houve patologia das vias aéreas associada. Esses são apenas dois exemplos que demonstram a complexidade das redes inflamatórias e como descobertas inesperadas em modelos animais levaram à busca de novos mediadores potenciais em doenças humanas.

Camundongos direcionados ao gene

Antes do advento do direcionamento de genes, vários camundongos mutantes naturais eram conhecidos por desenvolver aumento do espaço aéreo, incluindo pele firme (Tsk +/-) 8, pálida 9, manchada 10, 11 e camundongos bege 12. Os defeitos genéticos para esses camundongos foram subsequentemente descoberto. Camundongos Tsk têm uma mutação na fibrilina-1, uma proteína de matriz que é um componente importante das fibras elásticas 13. Embora as consequências dessa mutação no desenvolvimento e reparo do pulmão sejam claras, a relação entre os defeitos genéticos em outros camundongos mutantes naturais a estrutura do pulmão ainda não é aparente. O enfisema em algumas dessas cepas, como o rato pálido 14, foi atribuído à redução de α1-antitripsina (α1-AT), no entanto, se semelhantes aos humanos, os níveis de α1-AT não são baixos o suficiente para causar enfisema. Na verdade, o locus genético para α1-AT no camundongo é muito complexo, com quatro a cinco genes (dependendo da cepa) que codificam proteínas & gt95% homólogas entre si 15, dois dos quais inibem a elastase de neutrófilos 16. Eliminando um desses genes (α1-AT não. 2), que inibe apenas um terço da atividade da elastase dos neutrófilos, é letal no embrião antes do desenvolvimento pulmonar (dados não publicados). Isso destaca as diferenças entre ratos e humanos que limitam a capacidade de tradução entre sistemas em alguns casos.

A perda de função por direcionamento de gene durante o desenvolvimento fetal também pode resultar em desenvolvimento pulmonar anormal e consequente aumento do espaço aéreo. Embora não seja enfisema pulmonar per se, a falta de um constituinte crítico sugere que a proteína é necessária para o desenvolvimento. Existem agora muitos exemplos de camundongos direcionados a genes que sofrem alveogênese anormal, incluindo camundongos com perda de transcrição e fatores de crescimento. Por exemplo, membros da grande família de fatores de crescimento de fibroblastos (FGF) são essenciais para vários estágios do desenvolvimento do pulmão de mamíferos. Os pulmões de camundongos direcionados a genes sem receptores para os receptores 3 e -4 do FGF (mas não nocautes únicos) têm alveogênese acentuadamente prejudicada com aumento da síntese de colágeno 17. Camundongos nulos com fator de crescimento A derivado de plaquetas carecem de miofibroblastos, que são uma chave fonte de tropoelastina e são necessários para a septação alveolar 18, 19. Camundongos deficientes em proteínas da matriz extacelular, particularmente aquelas envolvidas na formação de fibra elástica, desenvolvem aumento do espaço aéreo 20. Os camundongos elastina - / - morrem dentro de 48 h após o nascimento, o que precede a alveolarização, mas o desenvolvimento anormal do pulmão pode ser apreciado então e em camundongos mutantes heterozigotos 21. Perda de proteínas microfibrilares, como a proteína de ligação de TGF-β latente-3 22, -4 23, fibulina-5 24 e fibrilina-1 20, todos também têm anormal desenvolvimento pulmonar.

Os camundongos Tsk +/- descritos anteriormente têm desenvolvimento pulmonar acentuadamente anormal 25. A anormalidade da estrutura pulmonar secundária à perda de fibrilina-1 permite o sequestro de TGF-β dentro da matriz e isso parece levar a septo alveolar anormal 25. Curiosamente, a administração de anticorpos neutralizantes de TGF-β para esses camundongos pós-natal produziu um aumento na septação alveolar.

O uso de camundongos direcionados a genes também demonstrou papéis complexos para TGF-β na DPOC. Os camundongos TGF-β - / - morrem de inflamação avassaladora dentro de 1 mês após o nascimento, limitando sua utilidade para estudar a DPOC. No entanto, camundongos com deficiência de β6-integrina, sem avb6, não ativa o TGF-β latente no pulmão. Esses camundongos também desenvolvem inflamação rica em macrófagos com produção excessiva de MMP-12. Camundongos Avb6 - / - apresentam desenvolvimento alveolar normal, mas, com o tempo, desenvolvem enfisema espontâneo 26. Sabe-se que o TGF-β inibe a produção de MMP-12. O retrocesso de camundongos avb6 - / - para MMP-12 - / - anula o enfisema, assim como o cruzamento desses camundongos com camundongos transgênicos com superexpressão de TGF-β. Embora a ausência total de TGF-β libere os freios na inflamação, muito TGF-β leva à fibrose das vias aéreas, outro componente importante da DPOC. O β6-mundongo deficiente representa um exemplo de camundongo direcionado a genes com desenvolvimento normal, mas enfisema espontâneo com o envelhecimento. Isso representa outro uso de camundongos direcionados a genes para determinar moléculas e vias importantes na DPOC.

Limitações de camundongos transgênicos e direcionados a genes

A tecnologia transgênica depende da introdução aleatória do gene de interesse no genoma receptor. Isso pode interferir na função de outros genes e, portanto, obter fenótipos idênticos em fundadores múltiplos é importante para garantir que o fenótipo esteja relacionado ao próprio transgene e não seja um efeito de integração. O direcionamento do gene é baseado na recombinação homóloga da mutação dentro do locus genético do gene de interesse e não sofre desta limitação.

Conforme discutido, a perda de um gene com um fenótipo resultante implica que ele desempenha um papel funcional importante, particularmente se aplicado a um modelo de doença. A introdução de um transgene resultando em um fenótipo sugere que ele poderia mediar esse fenótipo se superexpresso na doença, mas não é necessariamente relevante. Por exemplo, com relação ao desenvolvimento pulmonar, a expressão de um transgene durante a alveogênese pode levar ao enfisema do desenvolvimento, prejudicando a interpretação de seu efeito no enfisema pulmonar (destruição de alvéolos maduros). O direcionamento de genes também pode levar a um desenvolvimento anormal, a diferença aqui sendo que o aumento do espaço aéreo de desenvolvimento com direcionamento de genes sugere um verdadeiro papel de desenvolvimento para esse gene, enquanto a superexpressão artificial de um transgene não.

Os camundongos em qualquer fundo consanguíneo são geneticamente idênticos; no entanto, quando os camundongos não estão em um fundo puro, as diferenças fenotípicas podem estar relacionadas a diferenças de cepas de fundo, e não à própria manipulação genética. Os irmãos da mesma ninhada no fundo misto ajudam, mas, dependendo do fenótipo, podem não ser suficientes.

A maior preocupação, é claro, é a utilidade dos estudos em camundongos na predição da fisiopatologia e patogênese humana. O pulmão do camundongo tem a mesma estrutura geral e mecanismos fisiológicos que o pulmão humano, no entanto, há exceções notáveis ​​que tornam a tradução para os humanos difícil. Por exemplo, a via aérea do rato tem poucas glândulas submucosas e apenas seis a oito ramos até que o bronquíolo terminal seja alcançado, que vai diretamente para o ducto alveolar. Os humanos têm & gt20 ramos antes de se tornarem os bronquíolos respiratórios, uma estrutura não presente em camundongos, que é o local da inflamação inicial e da gênese do enfisema centriacinar. Além disso, os camundongos nem sempre expressam proteínas idênticas às dos humanos, como visto no exemplo anterior de MMP-1. No entanto, embora a estrutura e a participação na função possam diferir, o presente autor afirma que as vias patológicas gerais em resposta ao estresse (por exemplo, fumaça de cigarro) são conservadas, portanto, uma compreensão única da patobiologia humana pode ser obtida. através da manipulação do genoma do camundongo. A precisão da tradução dependerá de uma série de fatores, alguns dos quais ainda estão sendo aprendidos agora. Quanto mais se sabe sobre as semelhanças e diferenças, melhor será o conhecimento obtido com a engenharia genética em camundongos para desenvolver terapia para doença pulmonar obstrutiva crônica.

Fatores que resultam no aumento do espaço aéreo em camundongos. Os camundongos podem obter espaços aéreos aumentados devido ao desenvolvimento anormal ou destruição de alvéolos maduros. A falha na septação durante a alveogênese que ocorre em camundongos transgênicos pode ter importância biológica se a proteína superexpressa tiver a capacidade de ser superexpressa no desenvolvimento do pulmão humano. Alveogênese anormal em camundongos knockout sugere que o produto é feito e se, por algum motivo, for perdido, isso pode resultar em doença. Nenhum dos mecanismos é diretamente relevante para o enfisema pulmonar, que é definido pela destruição dos espaços aéreos que antes eram normais. Este fenótipo pode ser observado em camundongos através da um dos seguintes: induzindo um transgene durante a idade adulta, ocorrência espontânea ao longo do tempo em camundongos direcionados a genes e administrando um agente prejudicial relevante (por exemplo. fumaça de cigarro) para camundongos direcionados a genes. Os camundongos podem então ser comparados com camundongos do tipo selvagem para determinar um papel na doença pulmonar obstrutiva crônica.


Reprodução de camundongos

Esperamos que esta informação seja útil para os investigadores que não estão familiarizados com a reprodução de camundongos ou que estão criando camundongos transgênicos ou com alvos genéticos pela primeira vez. Essas sugestões são baseadas em nossa experiência. Eles estão abertos a modificações e não devem ser interpretados como um conjunto abrangente de regras.

Recomendações de reprodução de camundongos

1. Mantenha registros de reprodução precisos. Faça um pedigree para cada fundador transgênico ou quimera de células-tronco embrionárias de camundongo.

2. Acasalar ratos quando estiverem sexualmente maduros (6 a 8 semanas de idade). Recomendamos que fundadores transgênicos ou quimeras sejam acasalados com camundongos C57BL / 6. Após 6 gerações de acasalamento com C57BL / 6, mais de 99% do fundo genético será C57BL / 6. Ao analisar a expressão do gene em um fundo C57BL / 6, qualquer influência do fundo genético na expressão do gene será controlada por comparação com camundongos C57BL / 6 normais. Alternativamente, as quimeras podem ser cruzadas com camundongos 129 / Sv + Tyr-c + p, que têm o mesmo genótipo das células-tronco embrionárias. Isso irá produzir camundongos com a mutação do gene alvo no fundo 129 / Sv + Tyr-c + p para comparação com a mutação no fundo C57BL / 6.

3. Espere ninhadas dentro de um mês após o acasalamento, uma vez que as fêmeas entram em cio a cada 3 ou 4 dias e o tempo de gestação dos camundongos é de 19-21 dias. Se nenhuma ninhada for produzida após um mês, você deve substituir os camundongos que está acasalando com seu fundador. É possível que o fundador do transgênico seja infértil devido às consequências da expressão do transgene ou por razões desconhecidas. É possível que quimeras fenotipicamente masculinas sejam inférteis porque são o resultado da colonização de um embrião feminino por células-tronco embrionárias masculinas.

4. Razões para usar camundongos C57BL / 6.

a) C57BL / 6 é uma cepa endogâmica padrão, comumente usada no melhoramento transgênico
b) acasalar camundongos 6 & # 8211 8 semanas de idade para melhor desempenho reprodutivo
eu. substitua os machos quando eles tiverem 1 ano de idade
ii. substitua as fêmeas após 6 ninhadas ou quando completarem 6 meses de idade
c) acasalar um macho fundador com 2 fêmeas para obter 2 ninhadas em sucessão próxima
d) acasalar uma fêmea fundadora com 1 macho
e) os ratos geralmente acasalam novamente no dia em que a fêmea dá à luz, resultando em uma segunda ninhada 3 semanas
após o primeiro.
f) para produzir animais rapidamente, gire 2 fêmeas através de uma gaiola masculina & # 8217s a cada 1 a 2 semanas
g) alojar fêmeas grávidas 1 ou 2 por gaiola para evitar gaiolas lotadas

5. Problemas e soluções comuns:

a) a fêmea pode não cuidar da primeira ninhada
adicione uma fêmea reprodutora comprovada para a gaiola como ajudante e tente novamente
b) a fêmea não se importa com nenhuma ninhada
mais frequentemente visto com 129 mulheres mantidas na cama, o que impede a construção
ninhos elaborados & # 8220 subterrâneos & # 8221
129 gaiolas de acasalamento devem incluir material de nidificação em todos os momentos
b) o macho pode canibalizar a ninhada
remova o macho da gaiola de acasalamento antes que a fêmea dê à luz
c) ratos de combate
eu. separar os ratos de combate, alojá-los em 1 por gaiola, se necessário
ii. mulheres normalmente não lutam
iii. os homens podem lutar nas seguintes circunstâncias:
macho é colocado em uma gaiola contendo outro (s) macho (s)
o macho é separado no desmame e depois reunido com os irmãos da mesma ninhada
macho é desmamado em uma gaiola que contém machos de outra ninhada
os machos são agressivos e podem começar a lutar sem motivo aparente
macho adulto ataca fêmea imatura quando a fêmea é colocada na gaiola masculina & # 8217s

6. Programação para marcação de orelha, biópsias de cauda, ​​desmame e acasalamento:

a) registrar os nascimentos no cartão da gaiola e no pedigree
b) colocar uma marca na orelha dos filhotes quando eles tiverem duas semanas de idade
c) obter biópsias da cauda à medida que você aplica marcas auriculares
d) isolar o DNA da cauda e determinar os genótipos antes que os filhotes tenham 21 dias de idade
e) registrar genótipos no pedigree
f) desmamar filhotes aos 21 dias
eu. remova os filhotes de suas mães
ii. descartar filhotes não transgênicos desnecessários
iii. abrigar machos e fêmeas separadamente
f) quando os ratos têm 6 semanas de idade, eles podem ser acasalados (ver 1. acima)

Criação de quimera de camundongo-célula ES

Com base em nossa experiência, propomos as seguintes diretrizes para a reprodução de quimeras. Se você tiver cerca de 10 quimeras para realizar a reprodução, essas diretrizes se aplicam. Se você tiver apenas um ou dois animais, crie-os indefinidamente até que possa produzir animais adicionais a partir de clones de células ES independentes. Você pode ter sorte de obter a transmissão da linha germinativa com baixa eficiência (definida como 1 filhote agouti em 200 filhotes nascidos). Recomendamos que você cruze suas quimeras com parceiros C57BL / 6. Filhotes produzidos a partir de espermatozoides derivados de células ES terão casacos agouti, metade desses animais deve carregar o gene-alvo. Filhotes produzidos a partir de espermatozoides derivados do embrião hospedeiro C57BL / 6 terão pelagem preta.

1. Descarte as quimeras femininas, a menos que você tenha quimeras femininas de alta contribuição e uma proporção sexual distorcida favorecendo as fêmeas (muitas quimeras femininas e poucas quimeras masculinas). Você provavelmente injetou uma linha de células X: O. As fêmeas podem dar transmissão por linha germinativa.

2. Cruze o máximo de machos que puder, observamos a transmissão da linha germinativa de machos com pequenas quantidades de pele cutia.

3. Crie machos agressivamente desde o início? gire 2 fêmeas através da gaiola masculina & # 8217s a cada duas semanas. Isso exigirá 3 gaiolas de 2 fêmeas, além da gaiola de reprodução dos machos & # 8217s. Não coloque o quimera macho em uma gaiola ocupada por fêmeas, elas podem atacá-lo.

5. Se as quimeras não produzirem filhotes após 8 semanas de reprodução e fêmeas em rotação, eles são inférteis e devem ser descartados. Se os machos produzirem 6 ou mais ninhadas sem transmitir, não é provável que tenham linhagem germinativa e devem ser descartados.

Manutenção de registros:

1. Estabeleça um Pedigree para cada animal fundador ou descendência acasalada.

2. Imprima cartões personalizados para gaiolas de acasalamento e de desmame. Os cartões da gaiola de acasalamento devem fornecer um resumo instantâneo da atividade na gaiola e servir como registros permanentes. O cartão de desmame permite a localização rápida dos camundongos de acordo com a linha e a marca da orelha.

3. Use uma folha de registro personalizada para registrar o número da marca de orelha, sexo, cor da pelagem, número de registro de DNA da cauda e genótipo para cada rato que está marcado e com cauda. Mantenha as folhas de registro com o pedigree.

4. Juntos, o pedigree, os cartões de acasalamento e as folhas de registro devem fornecer as seguintes informações para cada camundongo: data de nascimento, sexo, número do brinco, cor da pelagem, número do registro do DNA, número da gaiola de acasalamento, números do brinco da mãe e do pai, origem da mãe e do pai, genótipo, data do acasalamento, data da eutanásia, motivo da eutanásia (por exemplo, análise de tecido), geração (quantas vezes a linhagem foi acasalada com C57BL / 6).

Resgate de tensão no mouse

Periodicamente, recebemos solicitações para ajudar a resgatar linhagens de camundongos que não estão mais se reproduzindo. Freqüentemente, os camundongos estão além de seus primeiros anos reprodutivos. Aqui estão algumas das abordagens que podem ser usadas para & # 8220rescuar & # 8221 cepas antigas.

1. Use camundongos C57BL / 6 F1 para criar novas gaiolas de reprodução (ver sugestões de reprodução de camundongos acima). A maioria dos híbridos C57BL / 6 F1 tem um bom desempenho reprodutivo. Preferimos animais (C57BL / 6J X DBA / 2J) F1. Camundongos CD-1 e ICR não-consanguíneos podem ser usados, mas introduzem mais complacência genética à linha.

2. Siga as fêmeas reprodutoras para obter os plugues de cópula. As fêmeas entram em cio a cada 3 dias ou mais. Acasale os animais na segunda-feira e siga-os para encontrar os plugues. Se eles não ligaram até sexta-feira, continue seguindo-os durante o fim de semana até que eles liguem ou desliguem e se reencontrem na segunda-feira. Alternativamente, o Transgenic Core pode acasalar camundongos fêmeas F1 superovulados com seu (s) macho (s) em um procedimento de rederivação. Os ovos são coletados das fêmeas e a fertilização é determinada sob o microscópio. Ovos fertilizados são transferidos para fêmeas pseudo-gestantes para a obtenção de filhotes. Se o macho não gerar óvulos fertilizados (sem tampões ou tampões sem fertilização, então a próxima etapa é a fertilização in vitro (consulte o item 3).

3. Se as fêmeas F1 se conectam, mas não ficam grávidas, os machos que você está usando para resgatar a linha são subférteis, por definição. Podemos sacrificar o (s) macho (s), coletar esperma e realizar um procedimento de fertilização in vitro (FIV). O Transgenic Core rotineiramente faz a fertilização in vitro com excelentes resultados. Uma vez, resgatamos uma linha do último homem, embora ele tenha morrido dois dias antes da fertilização in vitro. Nesse caso, o macho morto era armazenado em um saco plástico lacrado (para evitar ressecamento) na geladeira até a FIV. Outra vez, resgatamos uma linhagem de camundongo de um único mutante masculino espontâneo com membros caudais ectópicos no lugar de um pênis (mutação polipódia & # 8211 gene Ppd no cromossomo X).

4. Se os machos F1 não conectam as fêmeas, então as fêmeas são provavelmente anovulatórias. Neste caso, você pode enviar as mulheres idosas para o Laboratório Jackson para transplante de ovário em uma mulher imunocomprometida (para evitar a rejeição do enxerto) e você poderá recuperar a linhagem desta forma. O Transgenic Core não oferece este serviço.

5. Se você tomou o cuidado de criopreservar a linha como ovos congelados, o Core pode descongelar os ovos e recuperar a linha. Se os espermatozoides foram criopreservados, podemos ou não ser capazes de recuperar a linhagem por FIV ou ICSI, dependendo da origem genética do esperma. Recomendamos que os espermatozoides congelados sejam testados para fertilização in vitro bem-sucedida antes de uma linha ser descontinuada.

6. Se a linha foi derivada de um clone de célula ES, ela pode ser reinjetada para gerar um novo conjunto de quimeras de linha germinativa.

7. Se a linha estiver disponível em outro laboratório, você pode importá-los.

Padrões de transmissão do transgene:

Três padrões de transmissão transgênica (Tg) ocorrem em animais transgênicos fundadores. A maioria dos animais fundadores transmite sua Tg a 50% de sua prole. Cerca de 10% a 20% dos fundadores são mosaico para a Tg devido à integração tardia da Tg durante a embriogênese. Uma proporção variável de fundadores (5% a 30%) tem mais de um local de integração Tg. A transmissão para 30% ou menos da prole é um sinal de que as células germinativas do fundador & # 8217s são um mosaico para os Tg. Nestes casos, é aconselhável verificar o status transgênico do fundador e criar o camundongo da forma mais eficiente possível. Fundadores com mais de uma integração de Tg podem transmitir a Tg para 80% ou mais de seus descendentes.Os diferentes locais de inserção geralmente segregam de forma independente. A análise de Southern blot desses descendentes é usada para agrupar camundongos de acordo com o local de inserção. Isso simplifica a análise da expressão do transgene, uma vez que os padrões de expressão associados a cada inserção independente são isolados uns dos outros. A descendência de fundadores transgênicos transmite o Tg como um gene Mendeliano normal, independentemente de o fundador ser mosaico ou multi-integrante.

Padrões de transmissão de direcionamento de genes:

Dois padrões de transmissão ocorrem em quimeras de camundongos de células-tronco embrionárias (ES). Eles transmitem ou não. As taxas de transmissão que observamos variam de 100% a 0,5%. Também podem ocorrer quimeras masculinas inférteis. Uma vez que as células ES são XY, apenas quimeras masculinas devem ser criadas. Recomendamos que você examine uma quimera macho em seis ninhadas antes de decidir desistir dela. Se uma quimera tem uma alta taxa de transmissão, você deve considerar acasalá-la diretamente com fêmeas da linhagem de camundongos 129 que corresponde à origem da linhagem de células ES para obter a mutação do gene alvo em um fundo consanguíneo.

Hemizigotos ou homozigotos?

Recomendamos que as linhagens transgênicas sejam mantidas como hemizigotos. A principal desvantagem de manter as linhagens como hemizigotos é que todos os descendentes precisam ser genotipados para determinar quais são transgênicos. O estabelecimento de linhagens transgênicas homozigotas é caro e envolve reprodução adicional para produzir os primeiros homozigotos. A reprodução de teste adicional é necessária para garantir a homozigosidade. É necessário tempo adicional para estabelecer uma linha homozigótica de um fundador de mosaico com transmissão transgênica limitada. O cruzamento extra será necessário para estabelecer linhagens homozigotas para cada local de integração em fundadores com integrações múltiplas. Se isso não for feito com cuidado, resultarão em animais com combinações de diferentes locais de integração. Isso complicará a interpretação dos resultados experimentais, uma vez que diferentes locais de integração podem ter diferentes padrões de expressão do transgene. Cerca de 5% dos eventos de integração do transgene interrompem um gene endógeno importante para o desenvolvimento normal (Meisler MH. 1992. Trends Genet. 8: 341). Os camundongos afetados podem exibir um fenótipo não associado ao transgene que pode obscurecer os efeitos da expressão do transgene. O cruzamento desigual entre matrizes de transgene em homozigotos pode resultar no rearranjo do transgene que afetará a expressão. Esse tipo de instabilidade ocorre com menos frequência em hemizigotos. Muitas outras dificuldades podem ser evitadas com a manutenção de linhagens transgênicas hemizigóticas.

Tabela 1. Algumas estatísticas vitais do rato doméstico, Mus Musculus

número de cromossomos 40
conteúdo de DNA diplóide de cerca de 6 pg por célula
3X109 bp por genoma haplóide
unidades de recombinação 1600 centimorgans (2000 Kb / cM)
número aproximado de genes§ 0,5 & # 8211 1,0 X 105
por cento do genoma como cinco famílias
de sequências de DNA altamente repetidas
(B1, B2, R, MIF-1 e EC1) ¥ 8 e # 8211 10%

Biologia Reprodutiva

tempo de gestação 19 e # 8211 21 dias
idade ao desmame 3 semanas
idade na maturidade sexual 6 e # 8211 8 semanas
peso aproximado ao nascer 1g
desmame 8 & # 8211 12g
adulto 30 e # 8211 40g (masculino e feminino)
vida útil no laboratório 1,5 & # 8211 2,5 anos
ninhada de tamanho médio 6 e # 8211 8
número total de ninhadas por
reprodutor fêmea 4 & # 8211 8
vida útil de reprodução das fêmeas 6 & # 8211 8 meses
vida útil reprodutiva de machos 18 & # 8211 24 meses

§McKusick, V.A. e F.H. Ruddle. 1977. O status do mapa genético dos cromossomos humanos. Science 196: 390-405.
¥ Bennett, K.L., R.E. Hill, D.F. Pietras, M. Woodworth-Gutai, C. Kane-Kass, J.M. Houston, J.K. Heath e N.D. Hastie. 1984. Famílias de DNA dispersas mais repetidas no genoma de camundongo. Mol. Célula. Biol. 4: 1561-1571.
Ä Parâmetros como tempo de gestação, peso, expectativa de vida, etc., variam entre as diferentes linhagens consanguíneas.
“O tamanho da ninhada depende do número de óvulos liberados na ovulação, da contagem de espermatozoides masculinos e da taxa de mortalidade pré-natal. Estes podem variar com a idade dos camundongos, paridade e condições ambientais (por exemplo, dieta, estresse, presença de macho estranho) e com a cepa (refletindo fatores genéticos, como a eficiência da placentação). A mortalidade pré-natal em cepas consanguíneas pode ser em torno de 10-20%.

Fontes de informação adicional

A Tabela 1 é adaptada de Manipulando o embrião de camundongo: um manual de laboratório, por B. Hogan, R. Beddington, F. Constantini e E. Lacey, publicado por Cold Spring Harbor Laboratory. Este livro contém uma excelente bibliografia para informações sobre linhagens e reprodução de camundongos.

Uma excelente fonte é a segunda edição do Biologia do Rato de Laboratório, pela equipe do Laboratório Jackson, publicado pela Blakiston Division of McGraw-Hill.

Informações adicionais sobre a criação de camundongos podem ser encontradas em:

  • Manual de camundongos JAX geneticamente padronizados , 1997. pelo Staff of the Jackson Laboratory, disponível no The Jackson Laboratory.
  • Abordagem sistemática para avaliação de mutações em camundongos . 2000. Sundberg, JP e Boggess D, eds. CRC Press, LLC, Boca Raton, Flórida.
  • Genética e transgênicos de camundongos: uma abordagem prática . 2000. Jackson, IJ e Abbott, CM, eds. Oxford University Press, Nova York.
  • Genética de camundongos: conceitos eAplicativos .1995. Silver, LM. Oxford University Press, Nova York. (Disponível).
  • O Guia do NIH para o Cuidado e Uso de Animais de Laboratório está disponível online.

Alguns pesquisadores precisarão conhecer os alelos em vários loci polimórficos transportados pelos fundadores transgênicos. Esta informação pode ser encontrada procurando os genótipos dos camundongos usados ​​para obter ovos fertilizados para microinjeção em:


MATERIAIS E MÉTODOS

Construções de DNA

Um fragmento EcoRI carregando a sequência de codificação rtTA e um sinal de localização nuclear N-terminal foi excisado do plasmídeo pSPC-rtTA (10), embotado pela enzima Klenow e inserido no plasmídeo pCALL2-IRES-EGFP (um presente do Dr. Corrine Lobe) em um site XhoI embotado. O vetor resultante (pCALL2-rtTA-IRES-EGFP) foi primeiro digerido com BglII, preenchido pela polimerase Klenow e depois cortado com NotI, e o fragmento contendo rtTA-IRES-EGFP foi isolado. O vetor pBigT (11) foi digerido primeiro com SalI, preenchido e subsequentemente digerido com NotI. O fragmento acima foi inserido neste vetor resultando em pBigT-rtTA-IRES-EGFP. Toda a inserção do último vetor foi liberada por dupla digestão AscI-PacI e inserida no vetor pROSA26-PA (11) digerido pelas mesmas enzimas. O vetor alvo resultante foi denominado pROSA26-rtTA (Figura 1A). Antes da introdução em células-tronco embrionárias (ES) de camundongo, o vetor foi linearizado com XhoI.

O promotor de podocina murina foi amplificado a partir de DNA genômico murino como descrito anteriormente (12) e clonado a montante do transgene NLS-Cre (um presente de B. Sauer).

Manipulação de células ES

As células ES de camundongo R1 (13) foram mantidas e manipuladas conforme descrito em outro lugar (14). Em resumo, 20 μg de vetor-alvo linearizado foram eletroporados em 10 7 células usando configurações de 500 μF e 250 V no Gene Pulser (Bio-Rad). Após 24 h, as células foram selecionadas para resistência à neomicina em G418 (170 μg / ml) por 8 dias. As colônias resistentes foram colhidas, expandidas e divididas em placas de 96 poços, e as placas mestre foram congeladas e armazenadas a -80 ° C até que a caracterização genética identificou os clones corretamente direcionados. Alguns desses clones direcionados foram descongelados das placas mestre, expandidos e submetidos a procedimentos adicionais descritos abaixo.

Para ativar a expressão de rtTA a partir do locus ROSA26, a transfecção dos clones direcionados selecionados com o vetor pCAGGS-Cre-PGK-puro (um presente de C. Lobe) foi realizada usando Lipofectamine 2000 (Invitrogen). Uma alíquota de 2 μg de plasmídeo circular foi transfectada em células que crescem em um prato de 35 mm de diâmetro. Durante a transfecção, o meio OPTI-MEM foi usado. A seleção de puromicina (1,25 μg / ml) foi aplicada e as colônias resistentes expandidas. A fluorescência verde foi detectada conforme descrito anteriormente (15).

O plasmídeo pBI-3 (um presente de H. Bujard) contém um elemento bidirecional responsivo à tetraciclina seguido pela sequência de codificação lacZ. Este vetor foi introduzido nas células ES por lipofecção de acordo com o protocolo acima. Após 5 h de transfecção, doxiciclina (Sigma) foi adicionada ao meio em diferentes concentrações. No dia seguinte à lipofecção, as células foram passadas 1: 5 e cultivadas por mais 1–2 dias na presença de doxiciclina (100 ng / ml) e, em seguida, coradas usando X-gal.

Geração de animais transgênicos

Camundongos quiméricos foram gerados por agregação de células ES-alvo com embriões em estágio de oito células, conforme descrito anteriormente (16). Os machos quiméricos transmissores da linha germinativa foram cruzados com fêmeas consanguíneas ICR e os descendentes foram genotipados por Southern blotting e PCR para a transmissão do transgene.

As linhas fundadoras transgênicas Cre-recombinase foram geradas conforme descrito anteriormente (17). Em relação ao transgene Podocin-Cre, quatro linhas fundadoras individuais foram cruzadas com a cepa repórter Z / EG (15) para determinar o grau e o momento da excisão de DNA mediada por Cre em podócitos.

Genotipagem por Southern blotting

Para detectar o direcionamento do locus ROSA26, o DNA genômico foi isolado das células ES cultivadas em placas de 96 poços (18), digerido com EcoRV e os fragmentos separados em gel de agarose a 0,7%. Southern blotting foi realizado conforme descrito anteriormente (19). Resumidamente, o DNA foi transferido para uma membrana de nitrocelulose (Hybond N Amersham) e hibridizado com uma sonda complementar a uma sequência a montante do braço de homologia 5 'do vetor (sonda externa) ou com uma sonda complementar ao gene neo (sonda interna ) (Figura 1A e B). O sinal radioativo foi detectado por imagem fosforescente. Para detectar a mutação em camundongos, 10 μg de DNA genômico foram extraídos de biópsias da cauda de camundongos e analisados ​​por hibridização Southern como acima.

Genotipagem por PCR

A PCR foi realizada em 25 μl de mistura de reação contendo tampão PCR padrão, MgCl 1,0 mM2, 200 μM dNTPs, 200 nM primers, 5 U Taq polimerase e 100 ng de DNA genômico isolado de biópsias de orelha de camundongo. Os iniciadores para a detecção do alelo ROSA26 direcionado contendo a cassete STOP foram os seguintes: ROSA5, GAGTTCTCTGCTGCCTCCTG e RTTA3, AAGACCGCGAAGAGTTTGTC. A reação resultou em uma banda de 215 bp. O alelo ROSA26 de tipo selvagem foi detectado por um amplicon de 322 bp usando os iniciadores ROSA5 e ROSA3: CGAGGCGGATACAAGCAATA. O programa de PCR foi o seguinte: desnaturação inicial por 1 min a 94 ° C seguida por 35 ciclos de 1 min a 94 ° C, 45 s a 62 ° C (alelo knock-in) ou 64 ° C (alelo de tipo selvagem) e 1 min a 72 ° C e uma extensão final de 5 min a 72 ° C. Os produtos de PCR foram detectados em gel de agarose a 2%.

Histologia

A coloração X-gal de células ES foi realizada conforme descrito anteriormente (15). Amostras de tecido embrionário e adulto foram dissecadas e fixadas durante a noite em 4% de PFA. No dia seguinte, as amostras foram lavadas extensivamente com 1 × PBS, desidratadas por meio de lavagens com álcool graduado e incluídas em cera de parafina conforme descrito anteriormente (20). As seções (7 μm) foram desparafinizadas e coradas com Hematoxilina e Eosina de Harris (Sigma Immunochemicals).


Na tabela abaixo, apresentamos muitas considerações que você pode considerar ao decidir a melhor maneira de buscar camundongos e ratos geneticamente modificados.

  • Animais disponíveis prontos para estudo
  • Licença regulamentar para criação de nova linha não exigida
  • Pesquisas publicadas sobre essas cepas podem estar disponíveis
  • O modelo se encaixa exatamente nas suas necessidades de pesquisa?
  • A integridade genética foi comprometida por protocolos de reprodução e / ou cuidados?
  • O modelo pode carregar os genes errados?
  • Qual é o estado de saúde?
  • Solicitar modelos geneticamente modificados de uma universidade pode resultar em meses de negociações de MTA e altas taxas de licença
  • Custo-benefício "por camundongo", uma vez que um núcleo transgênico é configurado
  • Colaboração de departamentos internos
  • Tempo e dinheiro para a configuração inicial e manutenção para permanecer "state-of-the-art" (equipamento e treinamento)
  • Quão complexa é a modificação do gene? (por exemplo, específico do tecido)
  • Como garantir a detecção de efeitos inesperados CRISPR * off & amp on-target
  • Complexidade dos esquemas de reprodução
  • Prioridade do projeto: Quando meu projeto começará e os cronogramas serão cumpridos?
  • Qual é o estado de saúde?
  • Conselhos de equipes científicas que trabalharam em uma ampla variedade de modelos
  • Aderência aos cronogramas do projeto
  • Conveniência e eficiência de amp na escolha de um fornecedor com serviços adicionais necessários
  • Alto status de saúde com reprodução sob os padrões VAF / Plus ® (SOPF)
  • Acesso e aconselhamento sobre a propriedade de licenciamento CRISPR * de propriedade intelectual
  • Os custos devem ser comparados ao custo total de instalação e manutenção de instalações transgênicas
  • Investimento e esforço podem ser redirecionados para pesquisa
  • O modelo certo pode ser preservado para projetos futuros
  • CRISPR * análise de efeito off- & amp on-target fornecida para gerar dados de modelo consistentes

* CRISPR-Cas9 usado sob licenças para patentes americanas e internacionais concedidas e pendentes do The Broad Institute e ERS Genomics Limited.


Produzindo uma planta transgênica

O método mais comum para a produção de plantas transgênicas é Transformação mediada por Agrobacterium (Figura ( PageIndex <1> )). Agrobacterium tumifaciens é uma bactéria do solo que, como parte de sua patogênese natural, injeta seu próprio indutor de tumor (Teu) plasmídeo em células de uma planta hospedeira. O T naturaleu O plasmídeo codifica genes promotores de crescimento que causam a formação de uma galha (ou seja, tumor) na planta, o que também fornece um ambiente para a proliferação do patógeno. Biólogos moleculares desenvolveram o Teu plasmídeo removendo os genes indutores de tumor e adicionando locais de restrição que tornam conveniente inserir qualquer DNA de interesse. Esta versão projetada é chamada de T-DNA (transfer-DNA) plasmídeo a bactéria transfere um fragmento linear deste plasmídeo que inclui as sequências de DNA conservadas & ldquoleft-border (LB) & rdquo, e right-border (RB) & rdquo DNA, e qualquer coisa entre elas (até cerca de 10 kb) . O fragmento linear de T-DNA é transportado para o núcleo, onde se recombina com o DNA do hospedeiro, provavelmente onde quer que ocorram quebras aleatórias nos cromossomos do hospedeiro e rsquos.

Figura ( PageIndex <1> ): Produção de uma planta transgênica usando transformação mediada por Agrobacterium. A bactéria foi transformada com um plasmídeo T-DNA que contém o transgene e um marcador selecionável que confere resistência a um herbicida ou antibiótico. Uma cultura bacteriana e tecido vegetal (por exemplo, um punção de folha) são co-cultivados em meio de crescimento em uma placa de Petri. Algumas das células vegetais serão infectadas pela bactéria, que transferirá o T-DNA para o citoplasma da planta. Em alguns casos, o transgene se integrará ao DNA cromossômico de uma célula vegetal. Na presença de certas combinações de hormônios, as células vegetais se desdiferenciam em uma massa de células chamada calo. A presença de um agente seletivo (por exemplo, herbicida ou antibiótico) no meio de crescimento evita que as células não transformadas se dividam. Portanto, idealmente, cada calo consiste apenas em células vegetais transgênicas. Os calos resistentes são transferidos para a mídia com outras combinações de hormônios que promovem a organogênese, ou seja, a diferenciação das células do calo em brotos e depois em raízes. As plantas transgênicas regeneradas são transferidas para o solo. Suas sementes podem ser colhidas e testadas para garantir que o transgene seja herdado de maneira estável. (Original-Deyholos-CC: AN)

Em Arabidopsis e em algumas outras espécies, as flores podem simplesmente ser mergulhadas em uma suspensão de Agrobacterium, e

1% das sementes resultantes serão transformadas. Na maioria das outras espécies de plantas, as células são induzidas por hormônios para formar uma massa de tecidos indiferenciados chamada calo. O Agrobacterium é aplicado a um calo e algumas células são transformadas, que podem então ser induzidas por outros hormônios para regenerar plantas inteiras (Figura ( PageIndex <2> )). Algumas espécies de plantas são resistentes (ou seja, & ldquorecalcitrante& rdquo) para transformação por Agrobacterium. Nessas situações, outras técnicas devem ser utilizadas, como bombardeio de partículas, em que o DNA é ligado não covalentemente a pequenas partículas metálicas, que são aceleradas por ar comprimido em tecido caloso, a partir do qual plantas transgênicas completas podem, às vezes, ser regeneradas. Em todos os métodos de transformação, a presença de um marcador selecionável (por exemplo, um gene que confere resistência a antibióticos ou resistência a herbicida) é útil para distinguir células transgênicas de células não transgênicas em um estágio inicial do processo de transformação.

Figura ( PageIndex <2> ): Organogênese de brotos de linho de calli. (Original-J. McDill-CC: AN)


Descrição detalhada

Camundongos Ai96 (RCL-GCaMP6s) (também chamados de Ai96) abrigam o alelo condicional Rosa-CAG-LSL-GCaMP6s, projetado com um cassete floxed-STOP a montante do indicador de cálcio variante lento GCaMP6 (GCaMP6s, consulte a descrição detalhada abaixo). Embora sob controle do endógeno Gt (ROSA) 26Sor regiões promotoras / intensificadoras e o promotor híbrido CAG, a expressão generalizada de GCaMP6s é evitada por cassetes STOP. Após a exposição à Cre recombinase, a fluorescência de EGFP é observada após a ligação ao cálcio (como a ativação neuronal).

Especificamente, o investigador doador relata que camundongos Ai96 não relataram níveis de fluorescência EGFP antes da exposição à Cre recombinase. Quando os camundongos Ai96 são criados com uma linha de driver Cre para criar animais transgênicos duplos (GCaMP6s + / Cre +), as células que expressam Cre exibem baixa fluorescência de EGFP na ausência de ligação de cálcio. Após a ligação do cálcio (como ativação neuronal), o aumento da fluorescência de EGFP é observado nessas células.

O investigador doador também relata que após a ativação neuronal, a intensidade fluorescente observada em camundongos Ai96 transgênicos duplos (GCaMP6s + / Cre +) é menor do que a do sistema Ai95 transgênico duplo usando o indicador de cálcio variante rápido GCaMP6 (GCaMP6f + / Cre + ver estoque nº 024105) . Embora ambos os sistemas utilizem genes de fusão GCaMP6 / EGFP dependentes de Cre, eles diferem na cinética e na sensibilidade de suas variantes GCaMP6.

Os camundongos heterozigotos Ai96 são viáveis ​​e férteis sem anormalidades físicas ou comportamentais grosseiras relatadas. O investigador doador não tentou gerar camundongos Ai96 homozigotos até o momento (março de 2014).

Para obter informações de caracterização, consulte as imagens no site do Allen Institute for Brain Science (imagens Ai96 (RCL-GCaMP6s)).

O indicador de cálcio variante lento GCaMP6 (GCaMP6s) é um detector ultrassensível de potenciais de ação neuronal único com decaimento mais lento e cinética de resposta (Chen et al. 2013 Nature 499: 295), e é uma versão aprimorada do GCaMP5G. O gene de fusão GCaMP6s foi projetado pelos Drs. Douglas Kim e Loren Looger (Janelia Farm, HHMI). Comparado ao GCaMP6f, a cinética mais lenta torna o GCaMP6s mais sensível e mais lento para decair. GCaMP6s tem um fragmento M13 de músculo liso de frango da quinase de cadeia leve de miosina, um EGFP circularmente permutado (com várias substituições de aminoácidos projetadas para otimizar a faixa dinâmica, fluorescência e sensibilidade de linha de base) e uma sequência de calmodulina de rato modificada para aumentar a mudança de fluorescência para cálcio pequeno transientes. Outras modificações no linker cpEGFP-para-CaM também melhoram a função do sensor. Na ausência de ligação de cálcio, a fluorescência EGFP fraca é esperada, pois há um poro de fora de seu cilindro para o cromóforo. Após a ligação do cálcio, este poro torna-se ocupado e a fluorescência é aumentada.


Arber S, Han B, Mendelsohn M, Smith M, Jessell TM, Sockanathan S (1999) Requisito para o gene homeobox Hb9 na consolidação da identidade do neurônio motor. Neuron 23 (4): 659-674

Bader M (2010) Modelos de ratos de doenças cardiovasculares. Métodos Mol Biol 597: 403-414

Brenner M, Kisseberth WC, Su Y, Besnard F, Messing A (1994) GFAP promoter directs astrocyte-specific expression in transgenic mice. J Neurosci 14: 1030–1037

Brown AJ, Fisher DA, Kouranova E, McCoy A, Forbes K, Wu Y, Henry R, ​​Ji D, Chambers A, Warren J, Shu W, Weinstein E, Cui X (2013) Nocaute de gene condicional de rato inteiro via edição de genoma . Métodos Nat 10: 638-640

Chen J, Li Y, Wang L, Lu M, Zhang X, Chopp M (2001) Benefício terapêutico da administração intravenosa de células do estroma da medula óssea após isquemia cerebral em ratos. Curso 32 (4): 1005–1011

Chou WC, Takeo M, Rabbani P, Hu H, Lee W, Chung YR, Carucci J, Overbeek P, Ito M (2013) A migração direta de células-tronco de melanócitos foliculares para a epiderme após ferimento ou irradiação UVB depende da sinalização de Mc1r. Nat Med 19 (7): 924-929

Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Engenharia de genoma multiplex usando sistemas CRISPR / Cas. Science 339: 819

Fan X, Petitt M, Gamboa M, Huang M, Dhal S, Druzin ML, Wu JC, Chen-Tsai Y, Nayak NR (2012) Transiente, indutível, expressão do gene específico da placenta em camundongos. Endocrinology 153 (11): 5637-5644

Feil R, Brocard J, Mascrez B, LeMeur M, Metzger D, Chambon P (1996) Ligand-enabled site-specific recombination in mice. Proc Natl Acad Sci USA 93: 10887–10890

Feil R, Wagner J, Metzger D, Chambon P (1997) Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem Biophys Res Commun 237: 752-757

Feil S, Valtcheva N., Feil R (2009) Inducible Cre mice. Protocolo. Protocolos de nocaute de gene, vol 530 dos métodos de série em biologia molecular. pp 343-363

Flood DG, Lin YG, Lang DM, Trusko SP, Hirsch JD, Savage MJ, Scott RW, Howland DS (2007) Um modelo de rato transgênico da doença de Alzheimer com deposição extracelular de Abeta. Neurobiol Aging 30 (7): 1078–1090

Franz WM, Mueller OJ, Fleischmann M et al (1999) O promotor da cadeia pesada da miosina de músculo liso de 2,3 kb direciona a expressão do gene no sistema vascular de camundongos e coelhos transgênicos. Cardiovasc Res 43: 1040–1048

Groth AC, Calos MP (2004) Phage integrases: biology and applications. J Mol Biol 335 (3): 667-678

Guenther C, Tasic B, Luo L, Bedell M, Kingsley D (2014) Uma base molecular para a clássica cor de cabelo loiro em europeus. Nat Genet. https://doi.org/10.1038/ng.2991

Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J (2013) Edição de genoma programada de RNA em células humanas. eLife 2: e00471

Keravala A, Groth AC, Jarrahian S, Thyagarajan B, Hoyt JJ, Kirby PJ, Calos MP (2006) Uma diversidade de serina fago integrases medeiam recombinação específica do local em células de mamíferos. Mol Gen Genom 276: 135-146

Kobayashi T, Ebihara S, Ishii K, Kobayashi T, Nishijima M, Endo S, Takakub A, Sakagami H, Kondoe K, Tashirog F, Miyazakig J, Obata K, Tamura S, Yanagawa Y (2003) Caracterização estrutural e funcional do rato promotor do gene glutamato descarboxilase 67. Biochem Biophys Acta 1628 (2003): 156-168

Lakso M, Sauer B, Mosinger J, Lee EJ, Manning RW, Yu SH, Mulder KL, Westphal H (1992) Ativação de oncogene direcionada por recombinação específica de local em camundongos transgênicos. PNAS 89: 6232-6236

Lange A, Gegg M, Burtscher GM, Bengel D, Kremmer E, Lickert H (2012) Fltp (T2AiCre): uma nova linha de mouse knock-in para o direcionamento condicional de genes em tecidos mono- e multiciliados distintos. Diferenciação 83 (2): S105 – S113. https://doi.org/10.1016/j.diff.2011.11.003

Lewandoski M (2001) Controle condicional da expressão gênica no camundongo. Nat Rev Genet 2: 743-755

Li J, Ishii T, Feinstein P, Mombaerts P (2004) A escolha do gene do receptor odorante é redefinida por transferência nuclear de neurônios sensoriais olfativos de camundongo. Nature 428 (6981): 393-399

Lobe CG, Nagy A (1998) Alteração condicional do genoma em camundongos. BioEssays 1998 (20): 200–208

Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM (2013) Engenharia do genoma humano guiada por RNA via Cas9. Science 39 (6121): 823–826. https://doi.org/10.1126/science.1232033

Meyer M, de Angelis MH, Wurst W, Kühn R (2010) Gene direcionamento por recombinação homóloga em zigotos de camundongo mediada por nucleases de dedo de zinco. Proc Natl Acad Sci USA 107 (34): 15022-15026

Meyer M, Ortiz O, Hrabé de Angelis M, Wurst W, Kühn R (2012) Modeling disease mutations by gene targeting in one-cell mouse embryos. Proc Natl Acad Sci USA 109 (24): 9354-9359

Minskaia E, Ryan MD (2013) Coexpressão de proteínas usando FMDV2A: efeito de resíduos de "ligante". Biomed Res Int 2013: 291730. https://doi.org/10.1155/2013/291730

Nakano T, Windrem M, Zappavigna V, Goldman SA (2005) Identificação do intensificador de Hb9 de 125 pares de bases conservado que especifica a expressão gênica para neurônios motores espinhais. Dev Biol 283 (2): 474-485

Ohtsuki S, Kamiya N, Hori S, Terasaki T (2005) Indução do gene seletivo do endotélio vascular pelo promotor / potenciador Tie2 no cérebro e retina de um rato transgênico. Pharm Res 22 (6): 852-857

Orban PC, Chui D, Marth JD (1992) Tissue- and site-specific DNA recombination in transgenic mice. Proc Natl Acad Sci USA 89: 6861-6865

Overstreet DH (1993) Ratos da linha sensível Flinders: um modelo animal genético de depressão. Neurosci Biobehav Rev 17 (1): 51-68

Rasiman G, Li Y (2007) Repair of neuronal pathways by olfactory ensheathing células. Nat Rev Neurosci 8 (4): 312–319

Rasmussen M, Kong L, Zhang GR, Liu M, Wang X, Szabo G, Curthoys NP, Geller AI (2007) Glutamatergic ou GABAergic neurônio específico, expressão de longo prazo em neurônios neocorticais de vetores HSV-1 livres de vírus auxiliar contendo o promotor da glutaminase ativada por fosfato, transportador-1 de glutamato vesicular ou descarboxilase do ácido glutâmico. Brain Res 1144: 19-32

Ruan J, Li H, Xu K, Wu T, Wei J, Zhou R, Liu Z, Mu Y, Yang S, Ouyang H, Chen-Tsai RY, Li K (2015) Batimento transgene mediado por CRISPR / Cas9 altamente eficiente em o locus H11 em porcos. Sci Rep 5: 14253. https://doi.org/10.1038/srep14253

Ryan MD, King AM, Thomas GP (1991) A clivagem da poliproteína do vírus da febre aftosa é mediada por resíduos localizados dentro de uma sequência de 19 aminoácidos. J Gen Virol 72: 2727–2732

Sasahara M, Fries JW, Raines EW, Gown AM, Westrum LE, Frosch MP, Bonthron DT, Ross R, Collins T (1991) PDGF B-chain em neurônios do sistema nervoso central, pituitária posterior e em um modelo transgênico. Célula 1: 217-227

Sauer B (1987) Functional expression of the Cre-Lox site-specific recombination system in the levedura Saccharomyces cerevisia. Mol Cell Biol 7: 2087–2096

Sauer B, Henderson N (1988) Site-specific DNA recombination in mamífero cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci USA 85: 5166–5170

Schlaeger TM, Bartunkova S, Lawitts JA, Teichmann G, Risau W, Deutsch U, Sato TN (1997) Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice. Proc Natl Acad Sci USA 94 (7): 3058–3063

Shaner NC, Steinbach PA, Tsien RY (2005) Um guia para escolher proteínas fluorescentes. Métodos Nat 2 (12): 905-909

Singh P, Schimenti JC, Bolcun-Filas E (2015) Um guia prático do geneticista de camundongos para aplicações CRISPR. Genética 199 (1): 1-15

Tasic B, Hippenmeyer S, Wang C, Gamboa M, Zong H, Chen-Tsai Y, Luo L (2011) Transgênese mediada por integrase específica de local em camundongos via injeção pronuclear. Proc Natl Acad Sci USA 108 (19): 7902-7907

Tasic B, Miyamichi K, Hippenmeyer S, Dani VS, Zeng H, Joo W, Zong H, Chen-Tsai Y, Luo L (2012) Extensions of MADM (análise de mosaico com marcadores duplos) em camundongos. PLoS ONE 7 (3): e33332. https://doi.org/10.1371/journal.pone.0033332

Vassalli A, Rothman A, Feinstein P, Zapotocky MP (2002) Minigene conferir orientação do axônio específico do receptor odorante no bulbo olfatório. Neuron 35: 681-695

Weber T, Schönig K, Tews B, Bartsch D (2011) Manipulações de genes induzíveis em neurônios serotonérgicos cerebrais de ratos transgênicos. PLoS ONE 6 (11): e28283

West AG, Gaszner M, Felsenfeld G (2002) Isoladores: muitas funções, muitos mecanismos. Genes Dev 16 (3): 271-288

Witten IB, Steinberg EE, Lee SY, Davidson TJ, Zalocusky KA, Brodsky M, Yizhar O, Cho SL, Gong S, Ramakrishnan C, Stuber GD, Tye KM, Janak PH, Deisseroth K (2011) Recombinase-driver rat lines: ferramentas, técnicas e aplicação optogenética ao reforço mediado pela dopamina. Neurônio 72 (5): 721-733

Yang X, Arber S, William C, Li L, Tanabe Y, Jessell TM, Birchmeier C, Burden SJ (2001) Patterning of muscle acetylcholine receptor gene expression in the aus ausent motor inervation. Neurônio 30 (2): 399–410

Young JI et al (1998) Autêntica expressão celular específica e regulada pelo desenvolvimento de fragmentos genômicos pró-opiomelanocortina em neurônios hipotalâmicos e rombencéfalos de camundongos transgênicos. J Neurosci 18: 6631-6640

Zhang J, Zhang L, Jiao H, Zhang Q, Zhang D, Lou D, Katz JL, Xu M (2006) C-Fox facilita a aquisição e extinção de alterações persistentes induzidas pela cocaína. J Neurosci 26 (51): 13287-13296

Zhu F, Gamboa M, Farruggio AP, Hippenmeyer S, Tasic B, Shule B, Chen-Tsai Y, Calos MP (2013) Dice, um sistema eficiente para edição genômica iterativa em células-tronco pluripotentes humanas. Nucleic Acid Res 42 (5): e34. https://doi.org/10.1093/nar/gkt1290


Atualizações e pesquisas atuais dos bolsistas ORIP

Número da concessão do pai: P51OD011106

PI: Ackerman, Steven A

Título do projeto pai: Apoio do Wisconsin National Primate Research Center
Título do suplemento administrativo: Apoio do Wisconsin National Primate Research Center

Resumo do Suplemento
O Wisconsin National Primate Center da University of Wisconsin-Madison irá renovar as suítes de quarentena no espaço ABSL3 por meio da compra e instalação de duas caixas de contenção de biobolhas prontas para uso, bem como equipamentos associados (ou seja, imagem, biologia molecular, diagnóstico, necropsia , etc.) para apoiar estudos de desafio SARS-CoV-2.

Fonte de financiamento suplementar: NIAID

Número de concessão do pai: P51OD011107

PI: Prasant Mohapatra

Título do projeto pai: Centro Nacional de Pesquisa de Primatas da Califórnia
Título do suplemento administrativo: Centro Nacional de Pesquisa de Primatas da Califórnia

Resumo do Suplemento
O California National Primate Research Center da University of California em Davis conduzirá um estudo terapêutico Operation Warp Speed ​​projetado para entender qual título de anticorpos neutralizantes é necessário para melhorar a doença em um modelo de primata não humano SARS-CoV-2 precoce pós-exposição, que representa pessoas que ter doença leve / pacientes ambulatoriais. Esta informação é necessária para informar os ensaios clínicos terapêuticos em humanos que estão atualmente sendo planejados e estabelecerão a base para estudos futuros para testar a eficácia mais tarde na infecção, representando pacientes hospitalizados com doença grave.

Fonte de financiamento suplementar: NIAID

Número de concessão do pai: P51 OD011132

Título do projeto pai: Apoio do Centro Nacional de Pesquisa de Primatas de Yerkes
Título do suplemento administrativo: Apoio do Centro Nacional de Pesquisa de Primatas de Yerkes

Resumo do Suplemento
O Centro Nacional de Pesquisa de Primatas de Yerkes na Emory University conduzirá vários aprimoramentos de instalações e equipamentos em apoio à pesquisa do COVID-19 nas instalações de ABSL-3 e BSL-3. O equipamento proposto para compra e uso fornecerá suporte ideal para uma grande base de projetos de pesquisa COVID-19 financiados pelo NIH no Yerkes NPRC, em última análise, contribuindo para o desenvolvimento de vacinas e terapêuticas seguras e eficazes para COVID-19.

Fonte de financiamento suplementar: NIAID

Número de concessão do pai: P51OD011107

PI: MOHAPATRA, PRASANT

Título do projeto pai: Centro Nacional de Pesquisa de Primatas da Califórnia
Título do suplemento administrativo: Centro Nacional de Pesquisa de Primatas da Califórnia

Resumo do Suplemento
O Centro Nacional de Pesquisa de Primatas da Califórnia da Universidade da Califórnia em Davis comprará estruturas aéreas de aço para dois currais de meio acre que apoiarão o aumento da reprodução para garantir um fluxo contínuo de macacos rhesus para pesquisas COVID-19, bem como equipamentos para um ABSL -3 suite para apoiar a pesquisa de doenças infecciosas em SARS-CoV-2.

Fonte de financiamento suplementar: NIAID

Número da concessão do pai: P51 OD011133

PI: Schlesinger, Larry S.

Título do projeto pai: Centro Nacional de Pesquisa de Primatas do Sudoeste - Geral
Título do suplemento administrativo: Expansão significativa da capacidade SNPRC ABSL3 na esteira do COVID-19

Resumo do Suplemento
O Southwest National Primate Research Center no Texas Biomedical Research Institute irá renovar e equipar uma instalação ABSL3 recentemente desativada, aumentando assim a capacidade ABSL3 para pesquisa COVID-19.

Fonte de financiamento suplementar: NIAID

Número de concessão do pai: P51OD011104

Título do projeto pai: Centro Nacional de Pesquisa de Primatas de Tulane
Título do suplemento administrativo: Melhorando os recursos de pesquisa no TNPRC para apoiar a pesquisa do COVID-19

Resumo do Suplemento
O Centro Nacional de Pesquisa de Primatas de Tulane na Universidade de Tulane enriquecerá os recursos de pesquisa para a pesquisa do COVID-19 por meio de dois aprimoramentos de recursos específicos: expansão da infraestrutura de alojamento de colônias reprodutoras de macacos rhesus livres de patógenos específicos (SPF) e a compra de instrumentação de laboratório de ponta para BSL -2/3 espaço de laboratório para apoiar estudos COVID-19.

Fonte de financiamento suplementar: NIAID

Número de concessão do pai: U42OD010442

Título do projeto pai: Estabelecimento de uma Colônia de Macacos Rhesus SPF
Título do suplemento administrativo: PCR e triagem de anticorpos para SARS-CoV-2 na colônia de macacos rhesus SNPRC

Resumo do Suplemento
O objetivo deste suplemento administrativo é rastrear toda a colônia de macacos rhesus SNPRC U42 para o vírus SARS-CoV-2 e anticorpos usando abordagens estabelecidas e desenvolver testes internos mais rápidos e menos caros para o SARS-CoV-2. Os métodos e resultados deste trabalho no SNPRC serão disseminados para outros centros de primatas que mantêm colônias reprodutoras de macacos SPF. O Centro implementará e desenvolverá métodos para vigilância de SARS-CoV-2 na colônia de reprodução de macacos rhesus SNPRC SPF, permitindo a detecção e mitigação de um surto de SARS-CoV-2 na colônia.

Fonte de financiamento suplementar: ORIP

Número da concessão do pai: U42OD011123

PI: Charlotte Hotchkiss (CONTATO)
Sally Thompson-Iritani

Título do projeto pai: WaNPRC Macaca nemestrina SPF Colônia de Reprodução
Título do suplemento administrativo: Desenvolvimento de um programa de testes COVID-19 para SPF M. nemestrina

Resumo do Suplemento
O objetivo deste suplemento administrativo é garantir que a atual pandemia COVID-19 não afete negativamente a saúde dos macacos pigtail dentro da colônia de reprodução SPF, afete a saúde dos indivíduos que trabalham com esses animais ou interfira na utilidade dos macacos pigtail como modelos para pesquisa de HIV / AIDS ou para pesquisa COVID-19 com animais excedentes. O Centro irá desenvolver e validar testes de vírus e anticorpos para coronavírus de macacos, incluindo SARS-CoV-2 e coronavírus sazonais em macacos pigtail, determinar os métodos de teste e amostragem mais eficientes e precisos e examinar animais dentro da colônia de macacos pigtail SPF. Os métodos e resultados deste trabalho no WaNPRC serão disseminados para outros centros de primatas que mantêm colônias reprodutoras de macacos SPF.

Fonte de financiamento suplementar: ORIP

Número da concessão do pai: U42OD010990-20W1

Título do projeto pai: Produção de Macacos Rhesus com Pedigree SPF
Título do suplemento administrativo: Centro Nacional de Pesquisa de Primatas da Califórnia

Resumo do Suplemento
O objetivo deste suplemento administrativo é expandir os agentes virais excluídos para as colônias de macacos SPF de nível 1 e 2 para incluir SARS-CoV-2, pois as populações de macacos SPF NHP estão em risco de COVID-19. O Centro implementará e desenvolverá métodos para vigilância de SARS-CoV-2 na colônia de reprodução de macacos rhesus CNPRC SPF, permitindo a detecção e mitigação de um surto de SARS-CoV-2 na colônia. Os métodos e resultados do trabalho serão disseminados para outros centros de primatas que mantêm colônias reprodutoras de macacos SPF por meio do Grupo de Trabalho de Detecção de Patógenos do NPRC e por meio de interações contínuas com a equipe do programa ORIP.

Fonte de financiamento suplementar: ORIP

Número da concessão do pai: U42OD011023

PI: Joyce Kimberly Cohen

Título do projeto pai: "Manutenção das colônias reprodutoras SPF no Centro Nacional de Pesquisa de Primatas de Yerkes"
Título do suplemento administrativo: "Manutenção das colônias reprodutoras SPF no Centro Nacional de Pesquisa de Primatas de Yerkes"

Resumo do Suplemento
"O objetivo deste suplemento administrativo é adicionar a triagem de evidências de infecção por SARS-CoV-2, desenvolvendo e implementando métodos moleculares e sorológicos para detectar infecção por SARS-CoV-2 e imunidade na colônia de macacos rhesus SPF no NPRC de Yerkes. A proposta também adicionará a triagem genética que definirá e determinará a frequência de alelos distintos que codificam ACE2 dentro da colônia. Os métodos e resultados deste trabalho em Yerkes serão disseminados para outros centros de primatas que abrigam colônias de macacos SPF. "

Fonte de financiamento suplementar: ORIP

Número de concessão do pai: P40OD028116

PI: Diogo Magnani (contato) Kathleen Engelman

Título do projeto pai: Recurso de anticorpo primata não humano para esgotamento de células imunológicas
Título do suplemento administrativo: Recurso de anticorpo primata não humano para esgotamento de células imunológicas

Resumo do Suplemento
"O objetivo deste suplemento administrativo é criar padrões de imunoglobulina de macaco de referência recombinante segura para facilitar o desenvolvimento e validação de ensaios confiáveis ​​para a detecção de coronavírus patogênicos e anticorpos antivirais em primatas não humanos (NHP) modelos animais de COVID. Especificamente, este suplemento irá financiar a geração dos seguintes reagentes: IgGs monoclonais rhesus reativos a coronavírus recombinantes e padrões de referência de soro NHP. Esses reagentes de anticorpos de referência para macacos melhorarão o desempenho e a comparabilidade de testes baseados em anticorpos para modelos de NHP, facilitando o desenvolvimento de testes de soro, treinamento de proficiência e comparações de desempenho entre laboratórios em centros e laboratórios do NHP.

Fonte de financiamento suplementar: ORIP

Número de concessão do pai: R24OD021324-05

Título do projeto pai: Sequenciamento genômico para estabelecer um genótipo de macaco e recurso de pesquisa de fenótipo
Título do suplemento administrativo: Recurso genômico e imunogenético para apoiar a pesquisa de primatas não humanos SRA-CoV-2 / COVID-19

Resumo do Suplemento
"O objetivo deste suplemento administrativo é estender um recurso centralizado (mGAP) para incluir a geração, análise e disseminação de variantes da sequência genômica de primatas não humanos usados ​​em estudos SARS-CoV-2 (o novo portal SARS-CoV-2 será localizado no site do mGAP). O trabalho proposto, em conjunto com o recurso do mGAP, apoiará estudos para compreender como a variação genética do hospedeiro influencia a eficácia da vacina e do tratamento. "


Assista o vídeo: How are transgenic animals made? (Janeiro 2022).