Em formação

Os repressores de fago CI e Mnt exibem diafonia?


Estou interessado em usar as proteínas CI e Mnt, bem como seus respectivos promotores (pR e Pmnt) dentro do mesmo sistema sintético, mas estou preocupado com sua similaridade e potencial crosstalk. Uma busca rápida na literatura não produziu resultados e um Multalin mostrou alguma homologia de sequência significativa (embora o Mnt forme um homodímero, enquanto o CI não).

Sequências: CI e pR, repressor Mnt e promotor Mnt

Já foi relatado que o repressor CI ou Mnt exibe crosstalk nos promotores pR e Pmnt?


Não há relatórios para isso ainda. Eu não acho que só porque eles mostram homologia geral, eles exibiriam crosstalk. Basta ver o alinhamento dos domínios de ligação ao DNA dessas proteínas primeiros ~ 70 resíduos do N-terminal. Além disso, seus DBDs pertencem a diferentes famílias de PFAM.

Da mesma forma com as sequências promotoras. Conforme relatado no site iGEM:

  • Promotor Mnt:tagatctcctatagtgagtcgtattaattt

  • promotor cI:gtgttgactattttacctctggcggtgata

Eles são bem diferentes. Além disso, se o iGEM tiver uma parte padrão relatada, como um componente de sistema biestável: promotor Mnt / cI (BBa_K228003), então ele teria sido praticamente padronizado. As peças iGEM geralmente são confiáveis.


Os repressores de fago CI e Mnt exibem diafonia? - Biologia

A regulação da expressão gênica por repressão transcricional é um mecanismo antigo e conservado que se manifesta de diversas maneiras. Aqui, resumimos as vias conservadas para a repressão transcricional prevalente em todas as formas de vida, bem como os mecanismos indiretos que parecem ter se originado em eucariotos, consistentes com o ambiente único de cromatina dos genes eucarióticos. As interações diretas entre os repressores transcricionais e a maquinaria transcricional central em bactérias e arquéias são suficientes para gerar um conjunto sofisticado de mecanismos que fornecem controle flexível. Essas interações diretas contrastam com a atividade dos co-compressores, que fornecem um controle regulatório adicional nos eucariotos. Sua modulação da estrutura da cromatina representa uma via indireta para regular negativamente a transcrição, e sua diversidade e modulação fornecem complexidade adicional adequada aos requisitos de padrões elaborados de repressão eucariótica. Novas descobertas indicam que os co-compressores não estão necessariamente restritos a gerar uma única saída estereotípica, mas podem exibir diversas respostas funcionais, dependendo do contexto em que são recrutados, fornecendo uma fonte adicional até então insuspeitada de diversidade no controle da transcrição. Os mecanismos dentro dos eucariotos parecem ser altamente conservados, com novos aspectos representados principalmente pela adição de estruturas de co-pressor específicas de linhagem que fornecem oportunidades adicionais para o recrutamento da mesma maquinaria principal.


Engenharia de controle de transcrição e aplicações em biologia sintética

Na biologia sintética, os pesquisadores montam componentes biológicos de novas maneiras para produzir sistemas com aplicações práticas. Uma dessas aplicações práticas é o controle do fluxo de informação genética (do ácido nucléico à proteína), também conhecida como regulação gênica. A regulação é crítica para otimizar os níveis de proteína (e, portanto, a atividade) e os níveis subsequentes de metabólitos e outras propriedades celulares. O dogma central da biologia molecular postula que o fluxo de informações começa com a transcrição e, consequentemente, as ferramentas regulatórias que visam a transcrição têm recebido mais atenção na biologia sintética. Nesta mini-revisão, destacamos muitos sucessos anteriores e resumimos as lições aprendidas no desenvolvimento de ferramentas para controlar a transcrição. Em particular, nos concentramos em estudos de engenharia onde promotores e terminadores de transcrição (cis-fatores) foram diretamente projetados e / ou isolados de bibliotecas de DNA. Também revisamos vários reguladores de transcrição bem caracterizados (trans-fatores), dando exemplos de como cis- e transFatores atuantes foram combinados para criar interruptores digitais e analógicos para regular a transcrição em resposta a vários sinais. Por último, fornecemos exemplos de como sistemas de controle de transcrição projetados têm sido usados ​​em engenharia metabólica e circuitos genéticos mais complicados. Embora a maior parte de nossa mini-revisão se concentre na bactéria bem caracterizada Escherichia coli, também fornecemos vários exemplos do uso de engenharia de controle de transcrição em organismos não-modelo. Abordagens semelhantes foram aplicadas fora do reino bacteriano, indicando que as lições aprendidas com os estudos bacterianos podem ser generalizadas para outros organismos.


Os repressores de fago CI e Mnt exibem diafonia? - Biologia

CTXϕ é um bacteriófago filamentoso que codifica a toxina da cólera e se integra ao Vibrio cholerae genoma para formar lisógenos estáveis. Em lisógenos CTXϕ, a expressão gênica originada do rstA O promotor do fago é reprimido pelo repressor RstR codificado pelo fago. A região N-terminal de RstR contém um elemento de ligação ao DNA hélice-volta-hélice semelhante à hélice-volta-hélice da família cI / Cro de repressores de fago, enquanto a região curta C-terminal não está relacionada ao domínio de oligomerização de repressor cI. RstR purificado com tag de His ligado a três locais de operação estendidos de 50 bp no rstA região promotora. Cada uma das pegadas de RstR exibiu um padrão alternado característico de regiões acessíveis à DNase I que sugeriu que o RstR se liga ao DNA como um dímero de dímeros. Em cromatografia de permeação em gel e experimentos de reticulação, RstR oligomerizou para formar dímeros e tetrâmeros. RstR mostrou ser tetramérico quando ligado ao DNA do operador por meio da realização de experimentos de mudança de mobilidade com misturas de RstR e uma variante ativa alongada de RstR. Ligação de RstR à alta afinidade O1 local poderia ser adequado a um modelo cooperativo de ligação de operador em que dois dímeros RstR se associam para formar complexos RstR-operador tetramérico. A ligação de dímeros RstR às metades esquerda ou direita de O1 o DNA do operador não foi observado em ensaios de mudança de mobilidade. Estas observações suportam um modelo no qual os contatos proteína-proteína entre dímeros RstR vizinhos contribuem para a forte ligação do operador.


Controle da expressão gênica nos colifagos modelo relacionados a P2: III. Sequência de DNA da principal região de controle do fago 186 ☆, ☆☆

o PSTO fragmento I (65,5% a 77,4%) do colifago 186, conhecido geneticamente por codificar os principais genes de controle, foi sequenciado e uma análise realizada para avaliar a capacidade de codificação, sinais de transcrição-tradução e para identificar quaisquer outras características significativas. Nossa análise indica que a região codifica: (1) sete genes, incluindo o int e cGenes I, que se sobrepõem, o gene de controle tardio B, e dois genes, denominados CP75 e CP76, que codificam proteínas de ligação ao DNA potenciais (2) um promotor pB e terminador tb para a transcrição direita do B gene, e prevemos a existência deste transcrito em um lisogênio (3) um promotor pL e terminador tL para a transcrição para a esquerda que codifica o int e cGenes I, e representa o transcrito lisogênico presumido (4) um promotor pR para a transcrição para a direita para dar o transcrito lítico presumido (precoce) que se sobrepõe e convergente com o transcrito lisogênico e, finalmente (5), um local de operador potencial para a ligação do repressor na região do pR promotor.

Evidências preliminares são apresentadas para apoiar esta análise.


Coevolução de bactérias e seus vírus

A coevolução entre bactérias e bacteriófagos pode ser caracterizada como uma batalha evolutiva constante infinita (corrida armamentista fago-hospedeiro), que começa durante a adsorção do fago e penetração na célula hospedeira, continua durante a replicação do fago dentro das células e permanece preservada também durante a lisogenia do profago. O bacteriófago pode existir dentro das células bacterianas em quatro formas com diferentes estratégias evolutivas: como um vírus replicante durante o ciclo lítico, em um estado de portador instável denominado pseudolisogenia, como um profago com genoma completo durante a lisogenia ou como um profago críptico defeituoso. Alguns mecanismos de defesa de bactérias e contra-medidas de vírus são caracterizados, e algumas questões evolutivas sobre a relação fago-hospedeiro são discutidas.

Esta é uma prévia do conteúdo da assinatura, acesso através de sua instituição.


Opções de acesso

Obtenha acesso completo ao diário por 1 ano

Todos os preços são preços NET.
O IVA será adicionado mais tarde no check-out.
O cálculo do imposto será finalizado durante o checkout.

Obtenha acesso limitado por tempo ou ao artigo completo no ReadCube.

Todos os preços são preços NET.


Redes regulatórias de host-profago

Como mencionado anteriormente, os genes da origem do fago representam uma grande parte da S. enterica genoma acessório. Alguns desses genes contribuem para a fisiologia do hospedeiro e, portanto, precisam ser expressos na hora certa e no lugar certo. Para tanto, passam a fazer parte da rede reguladora de bactérias. Como a aquisição desses novos genes não perturba o funcionamento bacteriano normal? Como eles são integrados à rede reguladora do host? Qual benefício potencial eles fornecem ao hospedeiro bacteriano? Como os reguladores bacterianos podem modular o comportamento do profago modulando a expressão do gene?

Controle de hospedeiro negativo de genes de profago

A expressão de novos genes não deve ser prejudicial para o hospedeiro bacteriano. Portanto, os genes adquiridos por transferência horizontal de genes (HGT) são geralmente primeiro silenciados antes de serem integrados na rede reguladora do hospedeiro. O silenciamento de genes de origem estrangeira pode, por exemplo, ocorrer através da A modificação do DNA ou envolve proteínas regulatórias que se ligam ao DNA para evitar a transcrição.

Uma das modificações mais estudadas no DNA é responsável por uma regulação epigenética chamada variação de fase e ocorre apenas em uma pequena fração da população bacteriana. Esta regulação depende da metilação de desoxiadenosinas pela metilase Dam (Deoxiadenosina metiltransferase) (Casadesús, 2016). A enzima Dam reconhece e modifica especificamente as sequências 5'-GATC-3 'quando essas sequências estão localizadas em uma região promotora, eventos de metilação podem bloquear a ligação de reguladores transcricionais e, consequentemente, modificar a expressão gênica. A metilação do DNA está envolvida no silenciamento de genes localizados nos profagos Gifsy1, Fels1 e ST64B em S. enterica SL1344 (Balbontín et al., 2006). Surpreendentemente, regula negativamente a maioria dos genes ST64B. Esta observação está de acordo com os resultados anteriores, mostrando que a excisão do ST64B é inibida pela regulação da Barragem (Alonso et al., 2005). Isso foi atribuído à regulação negativa de dois genes localizados neste profago e que codificam proteínas envolvidas na indução de fagos: o anti-repressor Sb41 e a proteína de replicação Sb42. O regulador bacteriano envolvido nesta regulação e prejudicado em sua função pela metilação de Dam não foi identificado até o momento. Enquanto a regulação Dam observada para genes localizados nos profagos Gifsy1 e Fels1 não afeta sua excisão, a excisão do profago SopEΦ é favorecida pela metilação Dam. No entanto, o regulador transcricional, bem como os genes alvo responsáveis ​​por este fenótipo não foram descritos (Alonso et al., 2005 ).

A regulação epigenética também está envolvida na regulação da glicosilação do antígeno O (consulte a seção de modificação de LPS). De fato, sob condições lisogênicas, a expressão do P22 codificado gtrABC operon é regulado pela metilação Dam e o regulador bacteriano OxyR (Broadbent et al., 2010 Davies et al., 2013). A região a montante do gtr operon contém vários locais de ligação OxyR, bem como vários locais de metilação. Dependendo do estado de metilação, o OxyR se liga a diferentes locais e pode atuar como um ativador ou repressor do sistema. A ligação de OxyR a um local diminui a metilação por Dam neste local e, portanto, aumenta sua própria ligação. Mas isso funciona também ao contrário: o aumento da metilação resulta em redução da ligação de OxyR, o que favorece a metilação, etc. Isso confere herdabilidade do estado de expressão ao sistema e apenas uma parte da população está em um estado "ON", levando a uma população heterogênea (Broadbent et al., 2010 García-Pastor et al., 2018). Pensa-se que este mecanismo regulador seja conservado entre a família de fagos temperados P22 e pode prevenir a superinfecção pelo mesmo ou por outros fagos que usam co-receptor de antígeno O semelhante durante um tempo limitado (Davies et al., 2013 ).

Outro fator envolvido no silenciamento de genes adquiridos pelo HGT, além dos genes core, é a proteína ligadora de DNA H-NS (Lucchini et al., 2006 Navarre et al., 2006). Ao ligar-se preferencialmente a sequências ricas em AT, esta proteína pode discriminar entre própria e não própria. Curiosamente, vários estudos sugerem que a regulação dependente de H-NS envolveria diferentes mecanismos para genes ancestrais ou genes adquiridos por HGT (Vivero et al., Baños de 2008 et al., 2009). Foi sugerido que os genes ancestrais seriam regulados diretamente pela ligação de H-NS, enquanto os genes adquiridos por HGT exigiriam a formação de heterodímeros entre H-NS e proteínas pertencentes à família Hha. Que características do promotor são necessárias para favorecer a ligação de homodímeros ou heterodímeros não são conhecidas. Na mesma ordem de ideia, as proteínas H-NS codificadas por plasmídeos conjugativos evoluíram para regular especificamente genes estranhos (Baños et al., 2009 2011). Isto pode ser devido a diferenças estruturais entre H-NS codificado por plasmídeo ou cromossomicamente codificado levando a diferentes afinidades para regiões promotoras. De fato, embora os domínios N- e C-terminais sejam conservados, a região de ligação apresenta alguma variabilidade que poderia ser responsável por essa regulação diferencial. Todas essas observações dizem respeito a genes adquiridos por HGT em geral, incluindo genes de origem fágica. No entanto, foi notado que o conteúdo GC de profagos na cepa de referência de S. enterica LT2 é semelhante ao conteúdo GC médio do genoma (Navarra et al., 2007). Assim, podemos nos perguntar se as conclusões feitas acima realmente se aplicam a genes de origem profago. Estudos focados especificamente na regulação desses genes estão faltando até o momento e precisam ser realizados para responder a essa pergunta. O trabalho em andamento em nosso laboratório sugere, no entanto, que H-NS regula os genes do profago que não foram identificados por abordagens globais em S. enterica ST4 / 74 e que esses regulamentos têm consequências na manutenção do profago no cromossomo hospedeiro (Wahl et al., não publicado).

Controle positivo do hospedeiro dos genes do profago

Além da regulação negativa que acabamos de mencionar, alguns reguladores bacterianos também regulam positivamente genes de origem profago. Surpreendentemente, se olharmos para os diferentes estudos transcriptômicos realizados em S. enterica para definir os alvos do regulador global, como PhoP, SlyA, ArcA, FNR ou RpoS, apenas um punhado de genes profagos foram identificados (Navarre et al., 2005 Fink et al., 2007 Evans et al., 2011 Lévi-Meyrueis et al., 2015). Além disso, o (s) mecanismo (s) molecular (is) que levam a essas regulamentações ou as consequências na fisiologia bacteriana raramente são examinados. Não surpreendentemente, o que mais tem sido estudado é a regulação de genes que codificam proteínas envolvidas na virulência e na colonização do hospedeiro. Esses estudos mostraram que genes sob o controle de reguladores bacterianos são idiotas, o que define genes regulados independentemente do resto do profago e conferindo uma vantagem (efeito de aptidão em condições específicas, como virulência) ao hospedeiro. Entre elas, estão várias proteínas efetoras secretadas por T3SS. Como acima mencionado, S. enterica possui dois T3SS codificados pela ilha de patogenicidade 1 e 2 (SPI1 e 2). Entre os reguladores conhecidos por controlar a expressão de genes localizados no SPI estão o regulador transcricional InvF pertencente à família AraC / XylS para SPI1, ele próprio regulado pelo regulador mestre HilD, e o sistema de dois componentes SsrAB para SPI2. Embora ambos os reguladores tenham sido inicialmente pensados ​​para serem dedicados apenas à regulação de genes localizados em SPI1 e 2, eles também regulam a expressão de efetores codificados por profago. De fato, InvF regula efetores de origem de profago secretados por SPI1, enquanto SsrAB controla efetores que são dependentes de SPI2.

Por exemplo, SopE é um fator de virulência codificado no profago SopEΦ em S. enterica SL1344 e secretado pelo sistema SPI1. Consequentemente, sopE a expressão é regulada por InvF, em associação com a proteína chaperon SicA (Darwin e Miller, 2000). O papel da SicA é provavelmente indireto, ao estabilizar ou permitir a função de um regulador transcricional até então não identificado envolvido na sopE regulamentação (Tucker e Galán, 2000).

Outros efetores codificados por profago são secretados por SPI2 e, como consequência, sua expressão depende do sistema de dois componentes SsrAB. Entre eles, GogB é codificado pelo primeiro gene do profago Gifsy1 em S. enterica SL1344. Curiosamente, foi mostrado que gogB a expressão é independente dos fatores do profago Gifsy1, uma vez que pode ser transferida por si mesma na forma enteropatogênica E. coli cepa E2348 / 69, expressa a partir de seu próprio promotor e segregada através da o T3SS de seu novo host. Isto mostra que gogB pode ser integrado facilmente na rede reguladora do host (Coombes et al., 2005). O conteúdo GC de gogB mostra diferenças com o conteúdo de GC de Gifsy1, sugerindo que este gene foi recentemente adquirido pelo profago. Além disso, gogB pode ser encontrado fora de Gifsy1 e nem sempre é codificado por profago, o que suporta ainda mais sua independência transcricional do profago Gifsy1 (Porwollik et al., 2002 ).

sseI é um gene localizado no profago Gifsy2, que codifica outro efetor T3SS. sseI a expressão é fortemente ativada pela ligação direta da forma fosforilada de SsrB em sua região promotora (Worley et al., 2000 Feng et al., 2004 ). sseI a expressão também é regulada pela forma fosforilada de OmpR, mas não está claro se esta regulação é direta ou dependente de SsrB (Feng et al., 2004). Curiosamente, a pseudogenização de sseI junto com a expressão superior de pgtE, que codifica uma proteína da membrana externa, permite S. enterica Adaptação ST313 para causar doença sistêmica (Carden et al., 2017 Hammarlöf et al., 2018). O aumento em pgtE a transcrição é devida a um único SNP em sua região promotora. Mais estudos são necessários para entender como essas mudanças na expressão gênica modificam S. enterica Comportamento ST313 (Hammarlöf et al., 2018 ).

SsrB também regula genes no fago remanescente SPI12. Entre os genes regulados, o STM2239 codifica uma proteína Q antiterminadora que interage com a RNA polimerase para facilitar a transcrição de promotores tardios. A ausência de STM2239 afeta a aptidão da bactéria dentro do hospedeiro. STM2239 permite a transcrição de genes codificados por fago, mas também de genes bacterianos envolvidos em vias metabólicas, incluindo modificação e transporte da ribose, síntese e reciclagem de acetil coenzima A, bem como metabolismo da galactose. Nenhum desses regulamentos foi mais caracterizado, mas especulou-se que alguns deles podem ser importantes para S. enterica aptidão dentro do anfitrião (Tomljenovic-Berube et al., 2013 ).

Genes bacterianos controlados por fago

Exceto para virulência, exemplos de processos bacterianos sob controle de profago são escassos (Fig. 1 e Tabela 1 subitem 1.2). No entanto, o P22 oferece uma bela ilustração de genes bacterianos que codificam proteínas envolvidas no metabolismo e sob o controle de um regulador de origem fágica. o dgo O operon está envolvido na captação e metabolismo do D-galactonato, uma importante fonte de carbono durante a proliferação intracelular. No S. enterica Cepa LT2, expressão do dgo operon é desreprimido na presença de Pid, ​​uma proteína codificada em um locus idiota em P22 (Cenens et al., 2013a 2013b). Essa regulação ocorre apenas quando o P22 passa por pseudolisogenia, sugerindo a existência de um programa genético dedicado a essa condição.

A regulação dependente de fago pode ser conservada entre bactérias intimamente relacionadas. É o caso do pckA gene que codifica uma fosfoenolpiruvato carboxicinase necessária para a gliconeogênese. No E. coli, este gene está sob o controle do repressor CI do fago λ (Chen et al., 2005). Interessantemente, pckA região regulatória é conservada entre Enterobacteriaceae e contém sequências homólogas a vários operadores de fago, sendo um deles o sítio de ligação para o repressor C2 de P22. Esta regulação compartilhada entre vários profagos pode ser parte de uma estratégia adaptativa para aumentar a aptidão dos lisógenos, reduzindo sua taxa de crescimento em condições limitadas por glicose (Chen et al., 2005 ).

Os profagos frequentemente se integram em genes que codificam tRNA. Um contra-exemplo é dado pelo fago ΦW104 que integra o cromossomo hospedeiro em um locus que codifica o sRNA de RyeA e RyeB localizado na fita de DNA oposta em S. enterica DT104 (Balbontín et al., 2008). O local de fixação para ΦW104 está dentro dos 23 últimos pares de bases de ryeB e corresponde a um site interno em centeio. Portanto, a lisogenização ΦW104 modifica a porção 5 ′ de centeio, levando a uma diminuição da transcrição de centeio e um aumento da transcrição de ryeB. Esta regulação transcricional tem prováveis ​​consequências fisiológicas no hospedeiro bacteriano, ao modificar a expressão de alvos de mRNA de RyeA e RyeB.

Finalmente, outro exemplo de regulação do gene hospedeiro envolve um gene localizado no profago Gifsy1, isrK (Hershko-Shalev et al., 2016). Este gene codifica um sRNA e um mRNA policistrônico longo compreendendo isrK, orf45, anrP e isrJ sequências de codificação. No entanto, não há tradução observada a partir deste mRNA a menos que IsrK sRNA esteja presente. Na verdade, o sRNA IrsK se liga ao lado do orf45 e facilita a ligação da subunidade ribossômica 30S a este local, levando à tradução de sequências a jusante e à produção da proteína AnrP. AnrP é um anti-repressor que ativa a transcrição de genes codificados por fago. Entre eles, ativa a expressão do antQ gene que codifica para o anti-terminador AntQ que interage e forma um complexo estável com a RNA polimerase. Isso leva a um alongamento transcricional aberrante, danos ao DNA e, finalmente, morte celular (Hershko-Shalev et al., 2016 ).

Todos os exemplos acima dizem respeito à regulação da expressão gênica. No entanto, os fagos também podem influenciar a fisiologia bacteriana por outros meios. Por exemplo, a liberação de colicina 1b em S. enterica SL1344 depende dos genes de lise do profago ST64B (Nedialkova et al., 2015). De fato, sob condições específicas, como dano ao DNA ou limitação de ferro, a colicina 1b se acumula na célula e precisa da indução de genes de lise ST64B para serem encontrados no meio extracelular. Curiosamente, a diafonia complexa entre ST64B e outros profagos presentes nessa cepa contribui para esta regulação e precisa de caracterização adicional.


Material e métodos

Material vegetal, condições de crescimento e plasmídeos

Zea mays cv Early Golden Bantam (EGB Olds Seeds, Madison, WI, EUA) foi usado para infecção com U. maydis. O milho foi cultivado em estufa (16 h: 8 h, ciclo claro: escuro, 28 ° C: 20 ° C). Nicotiana benthamiana as plantas foram cultivadas em uma câmara de crescimento (16 h: 8 h, ciclo claro: escuro, 22 ° C, 60% de umidade). Arabidopsis thaliana As linhas indutíveis de β-estradiol XVE-jsi1-mCherry e as linhas de controle XVE-mCherry foram criadas por transferência de inserção de DNA no fundo Col-0. Arabidopsis thaliana as plantas foram cultivadas em uma câmara de crescimento (12 h: 12 h, ciclo claro: escuro, 21 ° C, 60% de umidade). Todos os plasmídeos usados ​​neste trabalho são fornecidos na Tabela S1 de Informações de Apoio. Clonagem detalhada, números de acesso de gene, ensaio de virulência e medições de fitohormônio são fornecidos nos Métodos S1.

Experimentos de secreção em cultura axênica e in planta

Ustilago Maydis cepa AB33Potefjsi1-3xHA foi gerado através da inserção do plasmídeo pUG-Potef-Jsi1-3xHA no ip locus de AB33 de acordo com Aichinger et al. (2003). Realizamos o ensaio de secreção de acordo com Brachmann et al. (2001). Os anticorpos monoclonais de camundongo anti-hemaglutinina (HA Sigma Aldrich) e anti-actina (Invitrogen) foram usados ​​para Western blot. A experiência foi repetida com três cepas transformantes independentes com resultados semelhantes.

Para visualizar a secreção de proteínas in planta, geramos o SG200Δjsi1Pcmu1Jsi1mCherry tensão integrando Jsi1-mCherry sob o controle do cmu1 promotor no ip locus. Além disso, construímos uma versão não secreta da cepa Jsi1-mCherry (SG200Pcmu1Jsi127641mCherry) Nós infectamos independentemente ambas as cepas em mudas de milho com 7 dias de idade. O sinal de fluorescência mCherry foi detectado usando microscopia confocal em 3 dias pós-infecção (dpi).

Ensaio de dois híbridos de levedura

Realizamos ensaios de dois híbridos de levedura (Y2H) com o sistema Matchmaker ™ GAL4 Two hybrid (Clontech®, Mountain View, CA, EUA) seguindo o protocolo do fabricante. Nós fundimos o domínio de ativação GAL4 do vetor presa pGG446 (versão modificada de pGADT7) aos genes Jsi127641, Jsi1m27641, ZmERF4, e proteína fluorescente amarela (YFP) Nós fundimos o domínio de ligação GAL4 do vetor de isca pGG187 (versão modificada de pGBKT7) aos genes ZmTPL1, ZmTPL2, ZmTPL3, TPL (AT1G15750), TPR1 (AT1G80490), TPR2 (AT3G16830), TPR4 (AT3G15880), YFPe porções N e C-terminais dos diferentes ortólogos em topless. Transformamos as combinações dos vetores pGG446 e pGG187 portadores dos diferentes genes nas cepas de levedura Y187 (MAT α) e AH109 (MAT a), respectivamente. Selecionamos a levedura diplóide após o acasalamento para crescimento em placas (SD) −Leu / −Trp e (SD) −Leu / −Trp / −His a 28 ° C por 4 d. Repetimos os experimentos duas vezes a partir de eventos de acasalamento independentes.

Ensaio de co-imunoprecipitação em N. benthamiana e Z. mays

Nos infiltramos com 4 semanas de idade N. benthamiana sai com Agrobacterium tumefaciens carregando diferentes genes clonados em um vetor de expressão conforme descrito (Ma et al., 2012). Culturas carregando as diferentes combinações de genes foram infiltradas em seis folhas (três plantas, duas folhas de cada planta). Uma amostra de 450 mg de pó de tecido foi suspensa em 2 ml de tampão de extração frio para extração de proteína (Hepes 50 mM pH 7,5, cloreto de sódio 100 mM, glicerol 10% v / v, EDTA 1 mM, Triton X-100 0,1% v / v , 2% de polivinilpolipirrolidona, 1 mM de ditiotreitol, 1 mM de fenilmetanossulfonilfluoreto e coquetel de inibidor de protease livre de EDTA Roche). O pull-down da proteína foi realizado usando o sistema μMACS ™ MicroBeads da Miltenyi Biotech (Bergisch Gladbach, Alemanha) seguindo as instruções do fabricante.

Quantificamos os sinais de proteína de ZmTPL1, ZmERF4 e as diferentes versões de Jsi1 na entrada. Os sinais de proteína de ZmTPL1, ZmERF4 e as diferentes versões de Jsi1 foram normalizados para o respectivo sinal de proteína Rubisco (Ponceau). Mudança de dobramento (FC) para cada proteína foi mostrada em relação ao valor de proteína normalizado observado em ZmTPL1 co-expresso com YFP ou Jsi1 e ZmERF4. A quantificação do sinal de proteínas puxadas para baixo de ZmERF4 e as diferentes versões de Jsi1 foram normalizadas para seus respectivos sinais de proteínas ZmTPL1 puxadas para baixo. FC para cada proteína foi mostrado em relação ao valor em ZmTPL1 co-expresso com Jsi1 e ZmERF4. Os valores de FC ± SD são médias de três réplicas biológicas para todos os experimentos.

No caso do milho, U. maydis cepas SG200Pcmu1jsi1-3xHA, SG200Pcmu1jsi1m-3xHAe SG200Pcmu1-SPcmu1 (1-22)-mCherry-3xHA foram gerados pela integração das diferentes construções no ip locus de SG200. Infectamos mudas de 7 dias de idade com cada cepa (30 plantas por cepa). O tecido infectado foi coletado 7 dpi. O protocolo de co-imunoprecipitação (Co-IP) foi o mesmo que para N. benthamiana.

Detectamos as proteínas imunoprecipitadas com anticorpos anti-MYC (Sigma Aldrich), anti-HA, anti-mCherry (Abcam) ou anti-proteína fluorescente verde (GFP Miltenyi Biotech), dependendo do experimento. O anticorpo específico para TPL foi criado usando um pequeno peptídeo, CNEQLSKYGDTKSAR, selecionado de uma região conservada das proteínas TPL / TPR. O anticorpo policlonal foi produzido em coelho pela Eurogentec (Seraing, Bélgica). Repetimos cada experimento três vezes.

Arabidopsis thaliana Coleta de amostra de sequenciamento de RNA

Arabidopsis thaliana sementes das linhas XVE-jsi1-mCherry-1/2 e XVE-mCherry foram cultivadas verticalmente em placas quadradas contendo meio Murashige & Skoog por 7 d. Arabidopsis thaliana as mudas foram transferidas para placas quadradas com o mesmo meio contendo 5 µM de β-estradiol e incubadas por 6 h. Três réplicas independentes para cada genótipo foram coletadas. O tratamento simulado foi realizado apenas para a linha de controle para confirmar que a concentração de β-estradiol usada para o experimento não alterou a expressão gênica.

Análise de sequenciamento de RNA

Removemos as sequências do adaptador e executamos o corte de qualidade usando T rimmomatic (Bolger et al., 2014). As leituras foram mapeadas para o genoma de referência usando S TAR, v.2.7.0e (Dobin et al., 2013) com o parâmetro outFilterMismatchNoverLmax 0,05. Entramos com os arquivos bam no R v.3.5.1 usando o pacote R / samtools. Obtivemos a anotação do genoma a partir de Araport11 e modelos gênicos e as contagens de leitura por gene foram obtidas com os pacotes G enomic F eatures e G enomic A lignments, respectivamente. Removemos genes de baixa expressão e analisamos 28.843 para expressão diferencial usando DES eq 2 após realizar transformação logarítmica regularizada (Love et al., 2014). Comparamos todas as réplicas das linhas XVE-jsi1-mCherry induzidas por β-estradiol com as réplicas das linhas de controle XVE-mCherry com e sem indução de β-estradiol e mantivemos os genes com log FC ˃ 1.5 e ajustados P & lt 0,05. Realizamos a análise do termo Gene Ontology (GO) para processos biológicos usando a ferramenta T hale M ine (Krishnakumar et al., 2014). Os conjuntos de dados foram depositados no Gene Expression Omnibus do National Center for Biotechnology Information (NCBI) e estão acessíveis através do GEO Series no. GSE142128 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE142128).

Para avaliar a importância do enriquecimento para os locais de ligação ao TF, primeiro determinamos os genes-alvo diretos de ERF3, 4, 7, 8, 10, 11 e ZAT10 usando dados de sequenciamento de purificação de afinidade de DNA disponíveis (DAP-seq) (O’Malley et al., 2016). Sobrepomos cada lista de genes alvos diretos putativos com genes regulados positivamente em jsi1 indução (FC ˃ 1,5, P & lt 0,05). Determinamos a significância dos genes sobrepostos com o teste exato de Fisher usando a função de sobreposição de genes do pacote R newGOM (https://github.com/shenlab-sinai/GeneOverlap).

PCR de transcrição reversa para validação de sequenciamento de RNA

O RNA total foi extraído de três réplicas independentes de cada A. thaliana linha (XVE-jsi1-mCherry-1 e 2 e XVE-mCherry) usando o mesmo protocolo para amostras de sequenciamento de RNA (RNA-seq). O DNA complementar (cDNA) foi gerado a partir do RNA total usando o kit de síntese de cDNA iScript (Bio-Rad). Realizamos a transcrição reversa quantitativa (qRT) -PCR usando FastStart Universal SYBR Green Master mix (Roche) de acordo com as instruções do fabricante. A quantidade relativa de amplicons nas amostras foi calculada com o método (Livak & Schmittgen, 2001) com actina 2 (AT3G18780) como o gene de referência (Czechowski et al., 2005). Calculamos o FC no nível de expressão de cada gene nas linhas XVE-jsi1-mCherry em comparação com a linha XVE-mCherry, e os dados são representados para cada linha jsi1-mCherry como a média de três repetições. Calculamos diferenças estatisticamente significativas na expressão do gene entre cada linha jsi1-mCherry e linha mCherry usando ANOVA seguido pelo teste de comparação múltipla de Dunnett com P & lt 0,05.

Para avaliação da indução do ramo ERF em milho, 10 mudas de EGB infectadas com SG200 foram coletadas aos 4 e 6 dpi. Mudas falsas foram infectadas com água e o tecido foi coletado para cada ponto de tempo. Três réplicas independentes foram realizadas para tecido infectado e simulado em cada ponto de tempo. Extração de RNA, síntese de cDNA e qRT-PCR e análise de dados foram realizadas conforme descrito anteriormente, mas usando uma quinase dependente de ciclina (CDK GRMZM2G149286) como o gene de referência (Lin et al., 2014). Os iniciadores usados ​​para RT-PCR são descritos na Tabela S2.

Transformação biolística de milho para localização e análise de indução gênica

Bombardeamos folhas de milho com 6 dias de idade com partículas de ouro de 1,6 µm revestidas com 5 µg de cada plasmídeo, conforme descrito por Djamei et al., (2011). Fluorescence emission was observed 1 d after transformation by confocal microscopy. For gene induction analysis, we bombarded 7 µg of the corresponding plasmids (35S-Jsi1-mcherry or 35S-Jsi1m-mcherry) into 12-d-old maize leaves. Samples were harvested 10 h after bombardment for RNA extraction and qRT-PCR.

Identification of putative secreted effector proteins with a DLNxxP motif

We downloaded predicted protein sequences of the different plant pathogens from EnsemblFungi (https://fungi.ensembl.org/index.html) or NCBI (https://www.ncbi.nlm.nih.gov/). To identify putative secreted effector proteins with a DLNxxP motif, we searched for the DLNxxP motif in all predicted proteins from the different fungal species using CLC M ain W orkbench 7.7.2 (Qiagen). Among all the DLNxxP-motif-containing proteins, we searched for those with a predicted secretion signal (S ignal IP-5.0), lacking transmembrane domains (T mhmm v . 2.0 from http://www.cbs.dtu.dk/services/), and no predicted enzymatic domains (I nter P ro , https://www.ebi.ac.uk/interpro/beta/).


Formulários

Bacteria and yeast are already used in numerous biotechnology applications such as fermentation and drug synthesis. The ability to engineer multicellular systems will drive vast improvements in existing applications as well as open up a wide variety of new possibilities. For example, programmed coordination of engineered bacteria or yeast can eliminate the need for monitoring of batch cultures and control of gene expression in such cultures through addition of expensive inducers ( Farmer and Liao, 2000 Chen and Weiss, 2005 ). New applications can be obtained by coupling gene regulatory networks with biosensor modules and biological response systems. Researchers interfaced a toggle switch with the SOS pathway detecting DNA damage as the biosensor module and biofilm formation as response output ( Kobayashi et al, 2004). Exposure of engineered cells to transient UV irradiation caused DNA damage, triggering the toggle switch to flip to the state that induced the formation of biofilms. In a similar study, a toggle switch was interfaced with the transgenic V. fischeri quorum-sensing module to sense when cells reach a critical threshold density. Engineering interactions between programmed bacteria and mammalian cells will lead to exciting medical applications. Recentemente, E. coli cells were engineered to invade specific mammalian cells exhibiting tumorigenic properties. Different plasmids were built containing the inv gene from Yersinia pseudotuburculosis under control of the Lux promoter, the hypoxia-responsive fdhF promoter, and the arabinose-inducible araBAD promoter. E. coli harboring these plasmids invaded cancer-derived cells in a density-dependent fashion, under anaerobic growth conditions, and upon arabinose induction, respectively ( Anderson et al, 2005). Synthetic biology will help the treatment of disease move beyond traditional approaches by allowing us to develop ‘smart’ therapies, where the therapeutic agent can perform computation and logic operations and make complex decisions. Also, the ability to engineer synthetic systems that can form spatial patterns is a critical step towards tissue engineering and fabrication of biomaterials ( Basu et al, 2005). Synthetic biology will open the doors to promising new applications, such as the production of alternative energy sources in live cells, biological computing, and bio-directed fabrication.


Notas de rodapé

Ahmed, S. A., Awosika, J., Baldwin, C., Bishop-Lilly, K. A., Biswas, B., Broomall, S., et al. (2012). Genomic comparison of Escherichia coli O104:H4 isolates from 2009 and 2011 reveals plasmid, and prophage heterogeneity, including Shiga toxin encoding phage stx2. PLoS One 7:e48228. doi: 10.1371/journal.pone.0048228

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Ferramenta básica de pesquisa de alinhamento local. J. Mol. Biol. 215, 403�. doi: 10.1016/S0022-2836(05)80360-2

Appleyard, R. K. (1954). Segregation of new lysogenic types during growth of a doubly lysogenic strain derived from Escherichia Coli K12. Genética 39, 440�.

Aravind, L., Leipe, D. D., and Koonin, E. V. (1998). Toprim𠄺 conserved catalytic domain in type IA and II topoisomerases, DnaG-type primases, OLD family nucleases and RecR proteins. Nucleic Acids Res. 26, 4205�. doi: 10.1093/nar/26.18.4205

Balasubramanian, S., Osburne, M. S., BrinJones, H., Tai, A. K., and Leong, J. M. (2019). Prophage induction, but not production of phage particles, is required for lethal disease in a microbiome-replete murine model of enterohemorrhagic E. coli infecção. PLoS Pathog. 15:e1007494. doi: 10.1371/journal.ppat.1007494

Bednarz, M., Halliday, J. A., Herman, C., and Golding, I. (2014). Revisiting bistability in the lysis/lysogeny circuit of bacteriophage lambda. PLoS One 9:e100876. doi: 10.1371/journal.pone.0100876

Beutin, L., Hammerl, J. A., Strauch, E., Reetz, J., Dieckmann, R., Kelner-Burgos, Y., et al. (2012). Spread of a distinct Stx2-encoding phage prototype among Escherichia coli O104:H4 strains from outbreaks in Germany, Norway, and Georgia. J. Virol. 86, 10444�. doi: 10.1128/JVI.00986-12

Bielaszewska, M., Mellmann, A., Zhang, W., Kཬk, R., Fruth, A., Bauwens, A., et al. (2011). Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. Lancet Infect. Dis. 11, 671�. doi: 10.1016/S1473-3099(11)70165-7

Boudailliez, B., Berquin, P., Mariani-Kurkdjian, P., Ilef, D. D., Cuvelier, B., Capek, I., et al. (1997). Possible person-to-person transmission of Escherichia coli O111 – associated hemolytic uremic syndrome. Pediatr. Nephrol. 11, 36�. doi: 10.1007/s004670050229

Carter, C. C., Fierer, J., Chiu, W. W., Looney, D. J., Strain, M., and Mehta, S. R. (2016). A novel Shiga toxin 1a-converting bacteriophage of Shigella sonnei with close relationship to Shiga toxin 2-converting pages of Escherichia coli. Open Forum Infect. Dis. 3:ofw079. doi: 10.1093/ofid/ofw079

Casjens, S. R., and Hendrix, R. W. (2015). Bacteriophage lambda: early pioneer and still relevant. Virologia 479�, 310�. doi: 10.1016/j.virol.2015.02.010

Croucher, N. J., Page, A. J., Connor, T. R., Delaney, A. J., Keane, J. A., Bentley, S. D., et al. (2015). Rapid phylogenetic analysis of large samples of recombinant bacterial whole genome sequences using Gubbins. Nucleic Acids Res. 43:e15. doi: 10.1093/nar/gku1196

Eppinger, M., Mammel, M. K., Leclerc, J. E., Ravel, J., and Cebula, T. A. (2011). Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U.S.A. 108, 20142�. doi: 10.1073/pnas.1107176108

Fogg, P. C. M., Saunders, J. R., McCarthy, A. J., and Allison, H. E. (2012). Cumulative effect of prophage burden on Shiga toxin production in Escherichia coli. Microbiology (Reading) 158, 488�. doi: 10.1099/mic.0.054981-0

Frank, C., Werber, D., Cramer, J. P., Askar, M., Faber, M., an der Heiden, M., et al. (2011). Epidemic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. N. Engl. J. Med. 365, 1771�. doi: 10.1056/NEJMoa1106483

Fuller, C. A., Pellino, C. A., Flagler, M. J., Strasser, J. E., and Weiss, A. A. (2011). Shiga toxin subtypes display dramatic differences in potency. Infectar. Immun. 79, 1329�. doi: 10.1128/IAI.01182-10

Gamage, S. D., Patton, A. K., Hanson, J. F., and Weiss, A. A. (2004). Diversity and host range of Shiga toxin-encoding phage. Infectar. Immun. 72, 7131�. doi: 10.1128/IAI.72.12.7131-7139.2004

Gamage, S. D., Strasser, J. E., Chalk, C. L., and Weiss, A. A. (2003). Nonpathogenic Escherichia coli can contribute to the production of Shiga toxin. Infectar. Immun. 71, 3107�. doi: 10.1128/iai.71.6.3107-3115.2003

Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P., and Blinov, V. M. (1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17, 4713�. doi: 10.1093/nar/17.12.4713

Gorbalenya, E. A., and Koonin, E. V. (1993). Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opiniões Struct. Biol. 3, 419�. doi: 10.1093/nar/26.2.391

Gordon, D. M., and O𠆛rien, C. L. (2006). Bacteriocin diversity and the frequency of multiple bacteriocin production in Escherichia coli. Microbiology (Reading) 152, 3239�. doi: 10.1099/mic.0.28690-0

Grad, Y. H., Lipsitch, M., Feldgarden, M., Arachchi, H. M., Cerqueira, G. C., FitzGerald, M., et al. (2012). Genomic epidemiology of the Escherichia coli O104:H4 outbreaks in Europe, 2011. Proc. Natl. Acad. Sci. EUA. 109, 3065�. doi: 10.1073/pnas.1121491109

Grande, L., Michelacci, V., Tozzoli, R., Ranieri, P., Maugliani, A., Caprioli, A., et al. (2014). Whole genome sequence comparison of vtx2-converting phages from enteroaggregative haemorrhagic Escherichia coli Deformação. BMC Genomics 15:574. doi: 10.1186/1471-2164-15-574

Hanahan, D. (1985). “Techniques for transformation of Escherichia coli,” in DNA Cloning: A Practical Approach, ed. D. M. Glover (McLean, VA: IRL Press), 109.

Iversen, H., L’ Abພ-Lund, T. M., Aspholm, M., Arnesen, L. P., and Lindb์k, T. (2015). Commensal E. coli Stx2 lysogens produce high levels of phages after spontaneous prophage induction. Frente. Célula. Infectar. Microbiol. 5:5. doi: 10.3389/fcimb.2015.00005

Kaiser, A. D. (1957). Mutations in a temperate bacteriophage affecting its ability to lysogenize Escherichia coli. Virologia 3, 42�. doi: 10.1016/0042-6822(57)90022-3

Katz, L. S., Griswold, T., Morrison, S. S., Caravas, J. A., Zhang, S., den Bakker, H. C., et al. (2019). Mashtree: a rapid comparison of whole genome sequence files. J. Open Source Softw. 4, 1762�. doi: 10.21105/joss.01762

Kimsey, H. H., and Waldor, M. K. (2009). Vibrio cholerae LexA coordinates CTX prophage gene expression. J. Bacteriol. 191, 6788�. doi: 10.1128/JB.00682-09

Kozłowska, K., Glinkowska, M., Boss, L., Gaffke, L., Deptuᐪ, J., and Wêgrzyn, G. (2020). Formation of complexes between O proteins and replication origin regions of Shiga toxin-converting bacteriophages. Frente. Mol. Biosci. 7:207. doi: 10.3389/fmolb.2020.00207

Krüger, A., and Lucchesi, P. M. (2015). Shiga toxins and stx phages: highly diverse entities. Microbiology (Reading) 161, 451�. doi: 10.1099/mic.0.000003

Kulasekara, B. R., Jacobs, M., Zhou, Y., Wu, Z., Sims, E., Saenphimmachak, C., et al. (2009). Analysis of the genome of the Escherichia coli O157:H7 2006 spinach-associated outbreak isolate indicates candidate genes that may enhance virulence. Infectar. Immun. 77, 3713�. doi: 10.1128/IAI.00198-09

L�ພ-Lund, T. M., Jørgensen, H. J., O’Sullivan, K., Bohlin, J., Ligård, G., Granum, P. E., et al. (2012). The highly virulent 2006 Norwegian EHEC O103:H25 outbreak strain is related to the 2011 German O104:H4 outbreak strain. PLoS One 7:e31413. doi: 10.1371/journal.pone.0031413

Lemire, S., Figueroa-Bossi, N., and Bossi, L. (2011). Bacteriophage crosstalk: coordination of prophage induction by trans-acting antirepressors. PLoS Genet. 7:e1002149. doi: 10.1371/journal.pgen.1002149

Licznerska, K., Nejman-Faleᑌzyk, B., Bloch, S., Dydecka, A., Topka, G., Gąsior, T., et al. (2016). Oxidative stress in Shiga toxin production by enterohemorrhagic Escherichia coli. Oxid. Med. Célula. Longev. 2016:3578368. doi: 10.1155/2016/3578368

Loś, J. M., Loś, M., and Wêgrzyn, G. (2011). Bacteriophages carrying Shiga toxin genes: genomic variations, detection and potential treatment of pathogenic bacteria. Future Microbiol. 6, 909�. doi: 10.2217/fmb.11.70

Makino, K., Yokoyama, K., Kubota, Y., Yutsudo, C. H., Kimura, S., Kurokawa, K., et al. (1999). Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 genes of the enterohemorrhagic Escherichia coli O157:H7 derived from the Sakai outbreak. Genes Genet. Syst. 74, 227�. doi: 10.1266/ggs.74.227

Mardanov, A. V., and Ravin, N. V. (2007). The antirepressor needed for induction of linear plasmid-prophage N15 belongs to the SOS regulon. J. bacteriol. 189, 6333�. doi: 10.1128/JB.00599-07

Mellmann, A., Bielaszewska, M., Kཬk, R., Friedrich, A. W., Fruth, A., Middendorf, B., et al. (2008). Analysis of collection of hemolytic uremic syndrome-associated enterohemorrhagic Escherichia coli. Emerg. Infectar. Dis. 14, 1287�. doi: 10.3201/eid1408.071082

Morabito, S., Karch, H., Mariani-Kurkdjian, P., Schmidt, H., Minelli, F., Bingen, E., et al. (1998). Enteroaggregative, Shiga toxin-producing Escherichia coli O111:H2 associated with an outbreak of hemolytic-uremic syndrome. J. Clin. Microbiol. 36, 840�. doi: 10.1128/JCM.36.3.840-842.1998

Nejman-Faleᑌzyk, B., Golec, P., Maciąg, M., Wegrzyn, A., and Wêgrzyn, G. (2012). Inhibition of development of Shiga toxin-converting bacteriophages by either treatment with citrate or amino acid starvation. Foodborne Pathog. Dis. 9, 13�. doi: 10.1089/fpd.2011.0980

Nowicki, D., Kobiela, W., Wêgrzyn, A., Wegrzyn, G., and Szalewska-Paᐪsz, A. (2013). ppGpp-dependent negative control of DNA replication of Shiga toxin-converting bacteriophages in Escherichia coli. J. Bacteriol. 195, 5007�. doi: 10.1128/JB.00592-13

O𠆛rien, A. D., Marques, L. R., Kerry, C. F., Newland, J. W., and Holmes, R. K. (1989). Shiga-like toxin converting phage of enterohemorrhagic Escherichia coli strain 933. Microb. Pathog. 6, 381�. doi: 10.1016/0882-4010(89)90080-6

O’Leary, N. A., Wright, M. W., Brister, J. R., Ciufo, S., Haddad, D., McVeigh, R., et al. (2016). Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 44, D733�. doi: 10.1093/nar/gkv1189

Plunkett, G. III, Rose, D. J., Durfee, T. J., and Blattner, F. R. (1999). Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product. J. Bacteriol. 181, 1767�. doi: 10.1128/JB.181.6.1767-1778.1999

Ptashne, M. (2004). A Genetic Switch Phage Lambda Revevisited, 3rd Edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Rasko, D. A., Webster, D. R., Sahl, J. W., Bashir, A., Boisen, N., Scheutz, F., et al. (2011). Origens do E. coli strain causing an outbreak of hemolytic-uremic syndrome in Germany. N. Engl. J. Med. 365, 709�. doi: 10.1056/NEJMoa1106920

Riley, L. W., Remis, R. S., Helgerson, S. D., McGee, H. B., Wells, J. G., Davis, B. R., et al. (1983). Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308, 681�. doi: 10.1056/NEJM198303243081203

Sato, T., Shimizu, T., Watarai, M., Kobayashi, M., Kano, S., Hamabata, T., et al. (2003). Genome analysis of a novel Shiga toxin 1 (Stx1)-converting phage which is closely related to Stx2-converting phages but not to other Stx1-converting phages. J. Bacteriol. 185, 3966�. doi: 10.1128/jb.185.13.3966-3971.2003

Scheutz, F., Teel, L. D., Beutin, L., Piérard, D., Buvens, G., Karch, H., et al. (2012). Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J. Clin. Microbiol. 50, 2951�. doi: 10.1128/JCM.00860-12

Schimmer, B., Nygard, K., Eriksen, H. M., Lassen, J., Lindstedt, B. A., Brandal, L. T., et al. (2008). Outbreak of haemolytic uraemic syndrome in Norway caused by stx2-positive Escherichia coli O103:H25 traced to cured mutton sausages. BMC Infect. Dis. 8:41. doi: 10.1186/1471-2334-8-41

Schmidt, H. (2001). Shiga-toxin-converting bacteriophages. Res. Microbiol. 152, 687�. doi: 10.1016/s0923-2508(01)01249-9

Schmidt, H., Bielaszewska, M., and Karch, H. (1999). Transduction of enteric Escherichia coli isolates with a derivative of Shiga toxin 2-encoding bacteriophage phi3538 isolated from Escherichia coli O157:H7. Appl. Environ. Microbiol. 65, 3855�. doi: 10.1128/AEM.65.9.3855-3861.1999

Serra-Moreno, R., Acosta, S., Hernalsteens, J. P., Jofre, J., and Muniesa, M. (2006). Use of the lambda red recombinase system to produce recombinant prophages carrying antibiotic resistance genes. BMC Mol. Biol. 7:31. doi: 10.1186/1471-2199-7-31

Shearwin, K. E., Brumby, A. M., and Egan, J. B. (1998). The Tum protein of coliphage 186 is an antirepressor. J. Biol. Chem. 273, 5708�. doi: 10.1074/jbc.273.10.5708

Sikorski, M. J., Hazen, T. H., Vyas, G., Michalski, J. M., and Rasko, D. A. (2020). Genome sequences of four Shigella boydii strains representative of the major S. boydii clados. Microbiol. Recurso. Announc. 9:e00881-20. doi: 10.1128/MRA.00881-20

Smith, D. L., Rooks, D. J., Fogg, P. C., Darby, A. C., Thomson, N. R., McCarthy, A. J., et al. (2012). Comparative genomics of Shiga toxin encoding bacteriophages. BMC Genomics 13:311. doi: 10.1186/1471-2164-13-311

Taylor, E. V., Nguyen, T. A., Machesky, K. D., Koch, E., Sotir, M. J., Bohm, S. R., et al. (2013). Multistate outbreak of Escherichia coli O145 infections associated with romaine lettuce consumption, 2010. J. Food Prot. 76, 939�. doi: 10.4315/0362-028X.JFP-12-503

Torres, A. G., Vazquez-Juarez, R. C., Tutt, C. B., and Garcia-Gallegos, J. G. (2005). Pathoadaptive mutation that mediates adherence of Shiga toxin-producing Escherichia coli O111. Infectar. Immun. 73, 4766�. doi: 10.1128/IAI.73.8.4766-4776.2005

Unkmeir, A., and Schmidt, H. (2000). Structural analysis of phage-borne stx genes and their flanking sequences in Shiga toxin-producing Escherichia coli e Shigella dysenteriae type 1 strains. Infectar. Immun. 68, 4856�. doi: 10.1128/iai.68.9.4856-4864.2000

Wagner, P. L., Acheson, D. W., and Waldor, M. K. (1999). Isogenic lysogens of diverse Shiga toxin 2-encoding bacteriophages produce markedly different amounts of Shiga toxin. Infectar. Immun. 67, 6710�. doi: 10.1128/iai.67.12.6710-6714.1999

Wegrzyn, G., and Wegrzyn, A. (2005). Genetic switches during bacteriophage lambda development. Prog. Nucleic Acid Res. Mol. Biol. 79, 1�. doi: 10.1016/S0079-6603(04)79001-7

Yin, S., Rusconi, B., Sanjar, F., Goswami, K., Xiaoli, L., Eppinger, M., et al. (2015). Escherichia coli O157:H7 strains harbor at least three distinct sequence types of Shiga toxin 2a-converting phages. BMC Genomics 16:733. doi: 10.1186/s12864-015-1934-1

Zeng, L., Skinner, S. O., Zong, C., Sippy, J., Feiss, M., and Golding, I. (2010). Decision making at a subcellular level determines the outcome of bacteriophage infection. Célula 141, 682�. doi: 10.1016/j.cell.2010.03.034

Zhou, Z., Alikhan, N. F., Mohamed, K., Fan, Y., and Achtman, M. (2020). The enterobase user’s guide, with case studies on Salmonella transmissions, Yersinia pestis phylogeny, and Escherichia core genomic diversity. Genome Res. 30, 138�. doi: 10.1101/gr.251678.119

Keywords : EHEC, bacteriophage lambda, lytic, phage replication, lysogen, Stx phage

Citation: Llarena A-K, Aspholm M, O’Sullivan K, Wêgrzyn G and Lindb์k T (2021) Replication Region Analysis Reveals Non-lambdoid Shiga Toxin Converting Bacteriophages. Frente. Microbiol. 12:640945. doi: 10.3389/fmicb.2021.640945

Received: 12 December 2020 Accepted: 16 February 2021
Published: 18 March 2021.

Maite Muniesa, University of Barcelona, Spain

Magaly Toro, University of Chile, Chile
Camilla Sekse, Norwegian Veterinary Institute (NVI), Norway

Copyright © 2021 Llarena, Aspholm, O’Sullivan, Wêgrzyn and Lindb์k. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. Não é permitida a utilização, distribuição ou reprodução em desacordo com estes termos.


Assista o vídeo: Тест коммутатора Zyxel GS1350 на грозозащиту (Janeiro 2022).