Em formação

Ensaio Enzimático - pectinase


Durante o ensaio de uma enzima em alta temperatura, o substrato (pectina) é degradado pela alta temperatura ao invés da enzima, então, como posso minimizar a degradação do substrato pela temperatura?


Trate previamente a enzima em alta temperatura antes de realizar o ensaio na temperatura padrão - Alan Boyd


Ensaio enzimático - pectinase - Biologia

As pectinases são, na verdade, uma mistura de enzimas que, junto com outras como a celulase, são amplamente utilizadas na indústria de sucos de frutas, onde são amplamente utilizadas para ajudar a extrair, clarificar e modificar os sucos de frutas. (Veja o rodapé desta página para mais informações)

As pectinas são grandes moléculas de polissacarídeos, constituídas (principalmente) por cadeias de várias centenas de resíduos de ácido galacturônico. As enzimas neste grupo de pectinase incluem poligalacturonases, pectina metil esterase e pectina liases. Essas enzimas pectinase atuam de maneiras diferentes sobre as pectinas, que são encontradas nas paredes celulares primárias e na lamela média. As pectinas também são conhecidas por sua capacidade de formar géis.

As pectinases são produzidas durante o processo de amadurecimento natural de algumas frutas, onde junto com as celulases ajudam a amolecer as paredes celulares. Essas enzimas também são secretadas por fitopatógenos, como o fungo Monilinia fructigena e a bactéria de podridão mole Erwinia carotovora, como parte de sua estratégia de penetração nas paredes celulares do hospedeiro vegetal. Na verdade, os produtos de tais agressões enzimáticas (oligossacarinas) atuam como um sinal que induz as células não infectadas a se defenderem.

O princípio deste ensaio depende da medição da quantidade de suco aquoso liberado do purê de maçã enlatado (que é muito rico em pectina) como resultado da ação da pectinase.

Purê de maçã enlatado ou engarrafado (molho) pode ser comprado para este ensaio.

    Para fazer um extrato da fruta ou vegetal, misture 2 cm 3 de água para cada 1 g de fruta. Prepare pelo menos 25 cm 3 de extrato.

As diferenças no volume do suco entre os dois tubos fornecem uma medida da atividade da pectinase no extrato.

Se esse experimento for realizado em larga escala, a drenagem inicial dos funis pode ser coletada em tubos de ensaio, para posteriormente medir o volume de caldo coletado.


Nota: ao usar enzimas preparadas comercialmente em suas investigações. . .

Muitos produtos enzimáticos industriais são misturas de diferentes enzimas. Assim, uma preparação de 'pectinase' pode conter uma variedade de pectinases e celulases. Outras preparações podem conter apenas um único tipo de enzima, especialmente se as enzimas são produzidas por cepas geneticamente modificadas ou são altamente purificadas.

Ao planejar suas próprias investigações, é muito importante estudar a folha de dados fornecida com cada enzima. Isso indicará se o produto é uma mistura ou contém apenas um tipo de enzima.

A folha de dados também fornece um guia aproximado de como a enzima pode se comportar. Na prática, no entanto, a atividade enzimática é afetada por muitas coisas (por exemplo, pH, temperatura, a presença de inibidores ou cofatores) que afetarão os resultados obtidos. Além disso, os gráficos de atividade dos espécimes são frequentemente preparados usando substâncias simples em condições ideais, em vez de substratos complexos e condições subótimas que podem ser encontradas em um contexto industrial ou escolar.

Em uma geléia e sem suco Um guia educacional NCBE / Unilever sobre enzimas na produção de suco de frutas


Pergunte a um especialista: Efeito da pectinase na produção de jucie

Estou fazendo meu projeto de biologia sobre produção de suco.
Estou investigando o efeito de diferentes enzimas na produção de suco de maçã.
Li um guia neste site e gostaria de saber: é necessário colocar enzima + maçã em banho-maria?

Re: Efeito da pectinase na produção de jucie

Postado por donnahardy2 & raquo Dom 18 de dezembro de 2011 18:58

Bem-vindo ao Science Buddies! Este é um ótimo projeto. Presumo que você esteja fazendo uma versão do seguinte projeto:

Neste projeto, as maçãs são picadas em pedaços muito pequenos de 5 mm e a enzima é adicionada à amostra com uma pequena quantidade de água. O procedimento sugere o uso de um banho de água a 40 graus centígrados, no entanto, você certamente poderia usar uma temperatura diferente. Já que parece que você vai experimentar diferentes enzimas, então a enzima será sua variável independente e a quantidade de suco será a variável dependente. Neste experimento, a temperatura deve ser um de seus parâmetros controlados e deve ser a mesma para todas as amostras. Você sabe qual é a temperatura ideal para a pectinase? E quanto às outras enzimas que você usará?

Você tem alguma outra pergunta?

Re: Efeito da pectinase na produção de jucie

Postado por umah11 & raquo Seg, 19 de dezembro de 2011 10:29

Muito obrigado pela sua resposta ...

Este é o problema. Não sei em que temperatura devo colocar as enzimas?

Estou usando enzimas diferentes, mas sei que algumas enzimas podem ser desnaturadas a 40 graus, então preciso descobrir todas as temperaturas ideais para cada enzima?

Outro site que achei recomendado não colocar a enzima + maçãs no banho-maria. Devo talvez fazer isso? Porque se eu mudar de temperatura, não quero que a enzima desnature.

Muito obrigado por sua ajuda

Re: Efeito da pectinase na produção de jucie

Postado por donnahardy2 & raquo Seg, 19 de dezembro de 2011 11h09

Aqui está um relatório que, embora não publicado em um jornal científico, parece confirmar que 40 graus centígrados é a temperatura ideal para a pectinase:

E o pH ideal é de 4,5 a 5,5:

Esta é uma fonte realmente boa de informações sobre a pectinase de uma das referências no artigo da Wikipedia:

Um banho de água quente definitivamente aceleraria a reação em comparação com a temperatura ambiente.

Que outras enzimas você planejava usar? Provavelmente, seria melhor usar a temperatura e o pH ideais para cada enzima.


O xilano e o ácido poligalacturônico foram adquiridos na Sigma Chemical Co., St. Louis, EUA. PectinexTM Ultra SP-L (uma preparação comercial de enzimas pectolíticas de uma cepa selecionada de Aspergillus niger) foi um gentil presente do Dr. J.S.Rao, Novozymes, Bangalore, Índia. Todos os outros produtos químicos usados ​​eram de qualidade analítica.

Determinação da atividade da pectinase

A atividade da pectinase foi estimada utilizando ácido poligalacturônico como substrato de acordo com o método descrito [21]. Uma unidade de atividade enzimática é definida como a quantidade de enzima necessária para produzir um μmol de ácido galacturônico por minuto nas condições de ensaio. A quantidade de ácido galacturônico foi estimada pelo método do ácido dinitrosalicíclico [22].

Determinação da atividade da xilanase

A atividade da xilanase foi estimada usando xilana como substrato [23]. Uma unidade de atividade enzimática é definida como a quantidade de enzima necessária para produzir um μmol de açúcar redutor por minuto nas condições de ensaio. A quantidade de açúcar redutor foi estimada usando o método do ácido dinitrosalicíclico [22].

Determinação da atividade da celulase

A atividade da celulase foi estimada usando carboximetilcelulose como substrato [24]. Uma unidade de atividade enzimática é definida como a quantidade de enzima necessária para produzir um μmol de açúcar redutor por minuto nas condições do ensaio. A quantidade de açúcar redutor foi estimada usando o método do ácido dinitrosalicíclico [22].

Estimativa de proteína

A concentração de proteína foi determinada de acordo com o procedimento descrito por Bradford [25] usando albumina de soro bovino como padrão.

Precipitação de enzimas por solventes orgânicos

Solventes orgânicos resfriados (acetona, dimetoxietano (DME) e n-propanol, 5 ml cada) foram adicionados gota a gota separadamente a 1 ml de preparação comercial Pectinex ™ Ultra SP-L com agitação e mantidos por 15 minutos a 4 ° C para precipitação completa de enzimas e, em seguida, centrifugado por 5 minutos a 10.000 × g. O sobrenadante foi descartado e o precipitado foi redissolvido em tampão de acetato de sódio 0,05 M pH 5. As atividades de pectinase, xilanase e celulase foram estimadas na solução.

Preparação de CLEA

N-propanol resfriado (5 ml) foi adicionado à solução enzimática bruta (1 ml) em tubos de centrífuga com tampa. Após manter a mistura por 15 minutos a 4 ° C para precipitação completa das enzimas, foram adicionadas várias quantidades de glutaraldeído. Os tubos foram agitados continuamente durante a adição. A mistura foi mantida a 4 ° C durante 4 h com agitação constante a 300 rpm. Ao final do tempo de reação, a suspensão foi centrifugada a 10.000 × g por 5 minutos. O sobrenadante foi decantado e os sedimentos foram lavados 3 vezes com tampão de acetato de sódio 0,05 M a pH 5 para remover o glutaraldeído que não reagiu. A preparação final da enzima foi mantida no mesmo tampão (1 ml) a 4 ° C.

Determinação de parâmetros cinéticos

Os parâmetros cinéticos de enzimas livres e CLEA foram determinados medindo as taxas iniciais de enzimas com quantidades variáveis ​​das respectivas soluções de substrato nas condições de ensaio. Os dados foram ajustados na equação de Hanes-Woolf usando o software Leonora para calcular os parâmetros cinéticos [26].

Estudo de estabilidade térmica

A estabilidade térmica foi determinada para pectinase, xilanase e celulase presentes em CLEA. No caso da pectinase, a estabilidade térmica da enzima livre e CLEA foi estudada a 50 ° C por 30 minutos e as da celulase e xilanase foram estudadas a 70 ° C e 60 ° C por 60 minutos, respectivamente. Nos três casos, a atividade em 0 minuto foi considerada como 100%.

PH e temperatura ótimos de pectinase, xilanase e celulase

O pH ótimo de pectinase, xilanase e celulase em CLEA foi estudado na faixa de pH de 3,5–9,5. A temperatura ótima de pectinase, xilanase e celulase na forma livre e em CLEA foi estudada no intervalo de 25–70 ° C.

Reutilização de pectinase, xilanase e celulase

Para avaliar a capacidade de reutilização de pectinase, xilanase e celulase em CLEA, o CLEA em cada caso foi lavado com o tampão de ensaio após cada uso e, em seguida, suspenso novamente em uma nova mistura de reação para medir a atividade enzimática. A atividade residual foi calculada considerando a atividade enzimática do primeiro ciclo como 100%.


INTRODUÇÃO

O efeito da temperatura na atividade enzimática foi descrito por dois parâmetros térmicos bem estabelecidos: a energia de ativação de Arrhenius, que descreve o efeito da temperatura na constante de velocidade catalítica, kgato, e estabilidade térmica, que descreve o efeito da temperatura na constante de taxa de inativação térmica, kinativo. As anomalias decorrentes desta descrição foram resolvidas pelo desenvolvimento [1] e validação [2] de um novo modelo (o Modelo de Equilíbrio) que descreve mais completamente o efeito da temperatura na atividade enzimática, incluindo um mecanismo adicional pelo qual a atividade enzimática diminui conforme a temperatura aumenta. Neste modelo, a forma ativa da enzima (Eagir) está em equilíbrio reversível com uma forma inativa (mas não desnaturada) (Einativo), e é a forma inativa que sofre inativação térmica irreversível ao estado termicamente desnaturado (X):

A Figura 1 mostra o efeito gráfico mais óbvio do Modelo, que é uma temperatura ótima (Toptar) em tempo zero (Figuras 1 A e & # x200B e 1B), 1 B), coincidindo com as observações experimentais [2]. Em contraste, o & # x02018Modelo Clássico & # x02019, que assume um equilíbrio simples de dois estados entre um estado ativo e um desnaturado termicamente (Eagir& # x02192X), e pode ser descrito em termos de apenas dois parâmetros (a energia de ativação de Arrhenius e a estabilidade térmica), mostra que quando os dados são plotados em três dimensões não há Toptar no tempo zero (Figura 1 C).

Além das diferenças óbvias nos gráficos que representam os dois modelos, foi observado experimentalmente que em qualquer temperatura acima da atividade máxima da enzima, a perda de atividade atribuível à mudança no Eagir/ Einativo o equilíbrio é muito rápido (& # x0003c1 & # x000a0s) em relação à perda de atividade devido à desnaturação térmica (mostrado na Figura 1 pelas linhas da taxa em relação ao tempo) [2]. Esta e outras evidências até o momento [2] sugerem que o fenômeno descrito pelo modelo (ou seja, o Eagir/ Einativo equilíbrio) surge de mudanças conformacionais localizadas em vez de mudanças globais na estrutura. No entanto, a extensão da mudança conformacional, e até que ponto ela poderia ser descrita como um desdobramento parcial, ainda não foi estabelecida.

O equilíbrio entre as formas ativa e inativa da enzima pode ser caracterizado em termos da entalpia de equilíbrio, & # x00394Heq, e um novo parâmetro térmico, Teq, que é a temperatura na qual as concentrações de Eagir e Einativo são iguais Teq pode, portanto, ser considerado como o equivalente térmico de Km. Teq tem significado fundamental e tecnológico. Tem implicações importantes para a nossa compreensão do efeito da temperatura nas reações enzimáticas dentro da célula e da evolução da enzima em resposta à temperatura, e possivelmente será uma melhor expressão do efeito da temperatura ambiente na evolução da enzima do que a estabilidade térmica. Teq assim, fornece um novo parâmetro importante para combinar as propriedades de uma enzima com sua função celular e ambiental. Teq também deve ser considerado em enzimas de engenharia para aplicações biotecnológicas em altas temperaturas [3]. A engenharia de enzimas é frequentemente direcionada para estabilizar enzimas contra a desnaturação, no entanto, aumentar a estabilidade térmica pode não aumentar a atividade de alta temperatura se Teq permanece inalterado.

A detecção da inativação reversível da enzima, que forma a base do Modelo de Equilíbrio, requer aquisição e processamento cuidadosos dos dados do ensaio devido ao número de influências conflitantes que surgem ao aumentar a temperatura de um ensaio enzimático. Determinação de Teq até o momento tem usado ensaios contínuos, porque este método produz curvas de progresso diretamente e evita a necessidade de realizar experimentos separados de atividade e estabilidade, e tem utilizado enzimas cujas reações são essencialmente irreversíveis (longe do equilíbrio da reação), não apresentam qualquer inibição de substrato ou produto e permanecer saturado com substrato ao longo do ensaio. No entanto, há um grande número de enzimas que não se enquadram nesses critérios, estreitando a utilidade potencial de determinar Teq. O presente artigo descreve métodos para a determinação confiável de Teq sob condições ideais ou não ideais de reação enzimática, usando ensaios contínuos ou descontínuos, e descreve os dados do ensaio necessários para a determinação precisa de Teq e as constantes termodinâmicas (& # x00394G& # x02021gato, & # x00394G& # x02021inativo e & # x00394Heq) associado ao modelo [2], também introduz um método de ajuste de curvas de progresso diretamente ao Modelo de Equilíbrio e determina a robustez dos procedimentos de ajuste de dados. Os resultados mostram diretamente como os parâmetros do modelo de equilíbrio são afetados pelos dados.

Os métodos descritos no presente trabalho permitem a determinação dos novos parâmetros & # x00394Heq e Teq, necessário para qualquer descrição da maneira como a temperatura afeta a atividade enzimática. Além disso, eles facilitam a determinação direta e simultânea de & # x00394G& # x02021gato e & # x00394G& # x02021inativo sob condições relativamente fisiológicas. Portanto, eles têm o potencial de ter um valor considerável no estudo puro e aplicado de enzimas.


Ensaio de pectinase - atividade de pectinase (05/06/2010)

aqui está um ensaio de worthington: ensaio de pectinase.

obrigado por sua resposta. sinto dificuldade em calcular a atividade. pode u plz fornecer-me a fonte para calcular a atividade das enzimas.

para ajudá-lo a calcular, precisamos saber o formato dos dados, as especificidades da reação (como concentração de enzima, concentração de substrato, etc), etc, e em quais unidades você deseja os resultados.

Iam usando uma concentração de enzima de 10mg / ml e concentração de substrato de 5mg / ml

finalmente, quando é lido em um espectrofotômetro, fornece um valor para a enzima e para o ácido D-galacturônico padrão.

agora como calcular a quantidade de ácido D-galacturônico liberado expressa em micromoles.

por favor, sugira-me alguns livros ou materiais sobre este cálculo. será tão útil para mim


Também tentei com o método DNSA para estimar os açúcares redutores, aqui também alguns problemas de cálculo.
Eu não tenho muito básico em bioquímica, então por favor me ajude.

são essas concentrações de estoque ou concentração no ensaio?

curva padrão do produto (procurando aumento) ou substrato (procurando diminuição) (forneça informações específicas)?


Pectinase extracelular de uma nova cepa SD de Bactéria Chryseobacterium indologenes e sua aplicação na clarificação de sucos de frutas.

As enzimas são moléculas biológicas que aceleram as reações bioquímicas. As pectinases são o grupo de enzimas que promovem a degradação de substâncias pécticas por meio da reação de despolimerização e desesterificação [1]. A pectinase também é um termo bem conhecido para a preparação de enzimas comerciais durante a clarificação de sucos de frutas. Esta enzima desune o ácido poligalacturônico em ácido mono-galacturônico, abrindo ligações glicosídicas [2].

No mercado mundial, foi relatado que a pectinase é responsável por 10% das enzimas industriais globais produzidas [3]. As enzimas pectinolíticas são produzidas por muitos organismos como bactérias, fungos, leveduras, insetos, nematóides, protozoários e plantas. Entre as várias pectinases, as pectinases bacterianas têm mais vantagens em relação às outras pectinases. Com o passar do tempo, muitos relatórios foram publicados sobre a otimização de diferentes parâmetros microbiológicos e estratégias de fermentação para a produção de pectinases [4].

As pectinases têm imensas aplicações nas indústrias de suco de frutas para melhorar a clareza e o rendimento do suco de fruta [5]. As pectinases também têm várias outras aplicações industriais, como limpeza de algodão, desgomagem de fibras vegetais, tratamento de águas residuais e extração de óleo vegetal, usados ​​em várias indústrias, como indústria de celulose, indústria têxtil, indústria alimentícia e assim por diante. A aplicação da enzima pectinase para alterar a textura ou sabor do suco de fruta, para aumentar a extração e clarificação, e para reduzir a viscosidade também foi descrita [6].

Mantendo todas as vantagens acima das enzimas pectinase em consideração, o objetivo do presente estudo foi projetado para isolar microrganismos pectinolíticos potenciais, otimizar suas condições culturais para a produção máxima de pectinase e investigar diferentes fatores envolvidos na atividade máxima da pectinase e também avaliar sua potencialidade em esclarecimento de suco de fruta diferente.

2.1. Amostragem e triagem. Bactérias produtoras de pectinase foram isoladas de resíduos de lixo vegetal. Das amostras coletadas, 40 isolados bacterianos foram isolados e purificados seguindo técnicas padrão de contagem em placa descritas por Dubey e Maheshwari [7]. Entre 40 isolados, oito isolados foram encontrados para produzir pectinase enquanto cresceram em meio de ágar pectina de extrato de levedura (YEP) durante a triagem primária. A triagem de bactérias produtoras de pectinase foi realizada em meio de ágar YEP contendo extrato de levedura 1%, pectina 1%, ágar 1,5% e NaCl 0,5% (pH 7,0) a 37 ° C por 48 horas de incubação. Após a incubação, as colônias mostrando zonas claras após a inundação com solução de iodeto de potássio-iodo (1,0 g de iodo, 5,0 g de iodeto de potássio e 330 mL [H.sub.2] O) foram selecionadas como produtores de pectinase [8] e o isolado K6 com a zona máxima de diâmetro foi precedido para estudos posteriores.

2.2. Identificação de cepas bacterianas selecionadas por características fenotípicas e bioquímicas. O isolado selecionado foi identificado por características morfológicas, culturais e bioquímicas. As características da colônia do isolado foram determinadas em ágar extrato de levedura-pectina e a morfologia celular pelo método de coloração de Gram. Para as características bioquímicas, vários testes como teste de citrato, teste de TSI (triplo açúcar ferro), teste de indol, MR-VP, motilidade, catalase, oxidase, hidrólise de amido e testes de fermentação para vários açúcares, como glicose, sacarose, lactose, maltose, testes de amido e manitol.

2.3. Identificação molecular do isolado bacteriano usando sequenciamento de rRNA 16S. Simultaneamente, este potencial isolado foi ainda identificado usando a ferramenta molecular de sequenciamento de rRNA 16S. Neste método, o kit de purificação de DNA Promega [R] Wizard [R] foi usado para a extração do DNA genômico do isolado selecionado. A região do gene 16S rRNA foi amplificada com os primers universais. As misturas de reação foram 5 [micro] L de molde, iniciadores: 1 [micro] L de iniciador direto: 27F (5'AGAGTTTGATCCTGGCTCAG 3 '), 1 [micro] L de iniciador reverso: 1492R (5' TACCTTGTTACGACTT 3 '), 6 [micro] l de tampão de ensaio, 2 [micro] l de Taq DNA polimerase e 5 [micro] l de mistura de dNTP. Os produtos de PCR foram purificados usando o PCR KlenzolTM e foram sequenciados com um sequenciamento de DNA de última geração. Os resultados do sequenciamento foram então processados ​​usando o software BioEdit. A análise da sequência de nucleotídeos foi feita usando o programa Basic Local Alignment Search Tool (BLAST) no site National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov). Os dados de sequência obtidos foram submetidos ao NCBI GenBank com o número de acesso KY684254. A análise filogenética foi conduzida no software Molecular Evolutionary Genetics Analysis versão 7.0 (MEGA7) [9].

2.4. Preparação do Inóculo. Para a produção da enzima pectinase, o inóculo foi preparado inoculando 10 mL de meio líquido YEP esterilizado em um tubo de ensaio com uma alça cheia de cultura pura e incubado a 125 rpm a 37 ° C. A cultura pura fresca cultivada durante a noite foi usada como um inóculo para uma produção aumentada de enzima.

2,5. Produção de enzima pectinase. O inóculo (5% v / v) foi transferido assepticamente para 50 mL de meio de produção (caldo de pectato de extrato de levedura apresentando a seguinte composição: extrato de levedura 1%, pectina 1%, NaCl 0,5% e água destilada 100 mL) em 250 mL frasco cônico e incubado a 37 [graus] C por 72 horas com 125 rpm em uma incubadora com agitação [10]. Após a incubação, o meio de produção foi centrifugado a 7000 rpm por 15 min a 4 [graus] C para obter o sobrenadante livre de células. O sobrenadante foi usado como a enzima bruta para estudos posteriores.

2.6. Ensaio de pectinase. A atividade da pectinase foi avaliada estimando-se a quantidade de açúcares redutores liberados nas condições de ensaio pela degradação enzimática da pectina cítrica. A mistura de reação contendo 1,8 ml de solução de substrato (pectina cítrica) e 0,2 ml de solução de enzima adequadamente diluída foi incubada a 40 [graus] C em banho-maria durante 1 hora. A quantidade de açúcar redutor liberado foi quantificada pela modificação de Nelson do método Somogyi [11,12]. Uma unidade de atividade enzimática (U) foi definida como a quantidade de enzima necessária para liberar 1 [micro] mol de açúcar redutor por ml por minuto sob condições de ensaio padrão (1U = 1 [micro] mol [min.sup.-1] [mL.sup.-1]) [13]. A intensidade da cor foi medida a 500 nm em um colorímetro [SpectroT60 (UV-VIS RS)] e comparada com uma curva padrão preparada com "D-glicose" (25-200 microgramas). O controle foi mantido com meio não inoculado e enzima fervida. A atividade relativa da enzima foi calculada como a porcentagem usando a seguinte fórmula:

Atividade relativa = Atividade da amostra x 100 / Atividade máxima da amostra (1)

2.7. Estimativa de proteína total. O teor de proteína total foi determinado pelo método de Lowry [14] medindo a absorbância a 600 nm e comparado com uma curva padrão preparada por albumina de soro bovino (BSA).

2.8. Otimização de diferentes fatores envolvidos na produção máxima de pectinase

2.8.1. Efeito da temperatura, pH e tempo de incubação. O isolado bacteriano foi submetido a diferentes condições de cultura para derivar as condições ideais para a produção máxima de pectinase. A produção de pectinase foi estimada em diferentes temperaturas (27, 30, 37, 40 e 45 [graus] C), uma ampla faixa de pH (5,0, 5,5, 6,0, 6,5, 7,0, 7,5, 8,0, 8,5 e 9,0), e diferentes períodos de incubação (24, 48, 72, 96 e 120 horas), e então a atividade enzimática foi mensurada.

2.8.2. Efeito das fontes de carbono e nitrogênio. Para estudar o efeito das fontes de carbono e nitrogênio na produção de pectinase do isolado selecionado, várias fontes de carbono (pectina cítrica, glicose, sacarose e amido) e fontes de nitrogênio (peptona, extrato de levedura, cloreto de amônio e nitrato de potássio) foram suplementadas em meio de produção a uma concentração de 0,5% p / v e, em seguida, a atividade da pectinase foi testada.

2.9. Otimização dos Parâmetros de Reação para a Atividade Máxima da Pectinase. Vários parâmetros de reação foram estudados para determinar as condições ótimas da atividade da pectinase bruta em diferentes temperaturas, pH, tempo de reação e concentração de substrato.

2.9.1. Efeito da temperatura e do pH. A temperatura e o pH ideais da enzima pectinase foram determinados incubando a mistura de reação com pH 7,5 a várias temperaturas (30, 37, 40 e 45 [graus] C) e, em seguida, uma faixa de pH (6,0, 6,5, 7,0, 7,5, 8,0, 8,5 e 9,0) a 40 [graus] C por 1 hora usando diferentes buffers, respectivamente. Para este propósito, o substrato (1% p / v de pectina cítrica) foi preparado em diferentes valores de pH (pH 6,0-9,0) usando tampão citrato-fosfato 0,2 M (pH 6,0-75) e tampão Tris-HCl 0,2 M (pH 8,0- 9.0). Em seguida, a atividade da pectinase foi avaliada usando o método de ensaio padrão.

2.9.2. Efeito do tempo de reação. Para a determinação do tempo de reação ideal, a estabilidade da enzima foi estudada incubando a mistura de reação por vários intervalos de tempo em 10 min, 20 min, 30 min, 40 min, 50 min e 60 min sob temperatura e pH otimizados e, em seguida, realizando o ensaio para atividade de pectinase.

2.9.3. Efeito da concentração de substrato. Para examinar o efeito da concentração de substrato durante a reação enzima-substrato, várias concentrações de pectina cítrica (0,5, 1,0, 1,5, 2,0, 2,5 e 3,0%) foram preparadas e, em seguida, a atividade enzimática foi medida.

2,10. Enzima de pectinase bruta na clarificação de sucos de frutas. Para observar o efeito da pectinase bruta na clarificação de diferentes sucos de frutas, os tubos foram rotulados como tratamento e controle. 10 ml de pectinase bruta foram colocados no tubo de ensaio (tratamento) e 10 ml de água destilada no tubo de ensaio de controle. Em seguida, vinte ml de suco de maçã / uva foram adicionados a ambos os tubos. O conteúdo dos tubos foi agitado para misturar as enzimas em todo o suco. Os tubos foram mantidos em banho-maria a 40 [graus] C. Os tubos foram observados em intervalos de 5 minutos ao longo do período de uma hora. Após a incubação, a solução foi filtrada [15].

Existem apenas alguns relatos sobre pectinases bacterianas até agora [16]. Neste estudo, pretendemos descobrir novas e potenciais bactérias pectinolíticas, para otimizar as condições culturais para aumentar a produção da enzima e caracterização parcial da enzima. Para tanto, coletamos resíduos de resíduos vegetais como fonte de potenciais organismos. Oito isolados foram selecionados principalmente a partir de 40 isolados bacterianos com base em sua atividade pectinolítica, conforme mostrado na Figura 1, durante a triagem e, finalmente, o isolado K6 foi selecionado para estudos posteriores.

3.1. Identificação do isolado bacteriano selecionado. Para identificar o isolado K6 selecionado, foram considerados métodos microbiológicos tradicionais e tecnologias moleculares modernas. Com base nas características morfológicas, culturais e bioquímicas observadas, o isolado selecionado foi comparado com a descrição padrão no Manual de Bacteriologia Determinativa de Bergey [17] e o isolado K6 foi provisoriamente identificado como Chryseobacterium indologenes.

Na base de dados do NCBI, o BLAST mostrou alinhamentos significativos de indologenes de Chryseobacterium com 95% de semelhanças. Além disso, a sequência obtida foi comparada com outras sequências relacionadas para encontrar o homólogo mais próximo no NCBI usando BLAST. A construção de uma árvore filogenética (Figura 2) foi feita com base nas sequências do gene 16S rRNA do isolado Chryseobacterium indologenes cepa SD e outras cepas de espécies de Chryseobacterium obtidas no banco de dados GenBank. As sequências de 16 nucleotídeos relacionadas foram usadas para construir a árvore filogenética usando o método de união de vizinhos [18]. A árvore de consenso bootstrap inferida a partir de 1000 repetições [19] é considerada para representar a história evolutiva dos táxons analisados ​​[19]. Ramificações correspondentes a partições reproduzidas em menos de 50% das réplicas de bootstrap são reduzidas. A porcentagem de árvores replicadas nas quais os táxons associados se agruparam no teste de bootstrap (1000 réplicas) é mostrada ao lado dos ramos [19]. As distâncias evolutivas foram calculadas usando o método de máxima verossimilhança composta [20] e estão nas unidades do número de substituições de base por site. A análise envolveu 16 sequências de nucleotídeos. Todas as posições contendo lacunas e dados perdidos foram eliminadas. Havia um total de 1323 posições no conjunto de dados final. As análises evolutivas foram conduzidas no MEGA7 [9]. Finalmente, o resultado obtido a partir das análises de rRNA 16S inferiu que a cepa SD de Chryseobacterium indologenes estava muito próxima de outras cepas de Chryseobacterium indologenes.

3.2. Estudos de Otimização do Isolado para Produção de Pectinase. Para otimizar as condições de cultivo desse organismo potencial no meio de produção, foram considerados diferentes temperaturas, pH, período de incubação e várias fontes de C e N. A produção da enzima aumentou com o aumento da temperatura até 37 [graus] C e depois diminuiu (Tabela 1). A produção máxima que ocorreu nesta temperatura foi de 0,679 U / ml (100% da atividade relativa). Isso reduziu drasticamente para quase 27% a 45 [degrees] C de temperatura. No estudo anterior de Aaisha e Barate (2016) [21], a maior produção de pectinase foi observada em algumas espécies de Bacillus a 37 [graus] C, o que é semelhante ao nosso estudo atual. Os mesmos achados também foram relatados por outros pesquisadores [22] no caso da cepa mutagênica de Leuconostoc mesenteroides.

A mesma tendência também foi observada quando este organismo foi permitido crescer no meio de produção em pH variável (Tabela 2). A produção máxima (0,564 U / ml) foi registrada em pH 7,5. Este achado está de acordo com outros trabalhadores que relataram que a maioria dos Bacillus sp. produzem grande quantidade de pectinase entre pH 7,5 e 8 [21, 23]. Em pH altamente ácido e alcalino, a produção da enzima diminuiu em quase 34% e 64%, respectivamente. A partir desse resultado, pode-se inferir que, em condições de pH muito baixo e muito alto, o crescimento do organismo diminui.

Foi feita uma tentativa de determinar o período de tempo mais favorável para a produção da enzima pelo isolado selecionado e a maior produção da enzima (0,594 U / ml) foi registrada em 72 horas de incubação (Tabela 3). A produção da enzima diminuiu gradualmente para 0,35 [micro] mol [min.sup.-1] [mL.sup.-1] em 120 horas de incubação, que é quase 40% menor do que o máximo. Isso pode ser devido ao acúmulo de produtos residuais no tempo de incubação prolongado com fontes de nutrientes limitadas que, conseqüentemente, suprimiram o crescimento de microorganismos. De acordo com Nawawi et al. (2017) [24], maximum pectinase production was determined from the Bacillus subtilis ADI1 after 72 hours of incubation which well agreed with our findings.

In this study, we also supplemented different types of carbon and nitrogen sources to find out the suitable production medium for pectinase production by Chryseobacterium indologenes strain SD. Among the four C sources, the organism lost almost 50% of production in case of sucrose utilization. It showed the highest production of 0.671 U/ml, while citrus pectin was used in the medium as C source and almost the same result was found in case of glucose supplement (Table 4) suggesting that the organism exploited citrus pectin more efficiently as compared to other C sources. Prakash et al. (2014) [25] observed the highest production of pectinase with lactose and glucose and Jayani et al. (2010) [26] reported citrus pectin as the best carbon source for pectinase production by Bacillus sphaericus. However, some researchers reported the maximum pectinase production from Bacillus subtilis ADI1 using rice brain as carbon source [24].

Likewise, the best enzyme production of this isolate was recorded when yeast extract was used as N source in the medium and the organism also produced nearly the same amount of enzyme when peptone was supplemented which indicates that this organism preferred yeast extract as compared to other N sources (Table 5). On top of that, our study revealed that organic nitrogen was used as better N sources by this organism than inorganic sources for enzyme production. These results are completely aligned with the findings of the other workers [25, 26].

Finally, by applying all the optimized parameters, the isolate was allowed to produce the enzyme in the production medium and we observed little increase in pectinase production (0.689 U/ml).

3.3. Total Protein Estimation for Crude Enzyme. Protein concentration of the crude enzyme was determined by Folin-Lowry method [14]. The total protein content was 1320 [micro]g/ml in the cell-free supernatant of Chryseobacterium indologenes strain SD.

3.4. Optimization Studies of Pectinase Activity. By growing the organism in the production medium under optimized conditions, the crude was collected by centrifugation to determine optimum conditions of the pectinase activity. Then the collected crude enzyme was allowed to react with different substrate concentrations (citrus pectin) at a wide range of temperatures, pH, and reaction time.

In this research work, the crude enzyme obtained from Chryseobacterium indologenes strain SD showed maximum activity at 40[degrees]C (Figure 3), whereas the organism showed the highest production at 37[degrees]C. This result is approximately similar to the result of other studies [27]. However, some studies reported [28] that pectinases from various Bacillus species were most active at 50[degrees]C and 60[degrees]C. From our study, it can be inferred that pectinase enzyme produced by the isolate is a moderately thermophilic enzyme.

Enzyme activity also depends on the pH of the reaction mixture. In our study, crude enzyme showed the highest activity at slightly alkaline pH 8 (Figure 4) and the organism also showed its maximum production at pH 7.5. Therefore, this enzyme can be used for vegetable purees and other preparations which need neutral to slightly alkaline pH [29]. This finding is in accordance with the reports of previous studies [28]. So, the result of our study indicates that this crude enzyme might be alkaline in nature.

As incubation time affects the activity of the enzyme, the crude enzyme was allowed to react with 1% of citrus pectin as substrate at optimized pH and temperature for different time intervals to determine its optimum reaction time. In our study, enzyme activity increased with the increase of incubation time up to 40 min and then remained stable in the subsequent incubation period (Figure 5). This result is in a good agreement with other studies [30].

The enzyme assay using different concentrations of substrate (citrus pectin) was observed and found that the enzyme activity augmented up to 2% of pectin and then it showed downward trend before being leveled off at 98% of relative activity in the subsequent increase of substrate concentration (Figure 6). This might be due to complete saturation of enzyme by the substrate.

3,5. Application of Crude Pectinase Enzyme in Fruit Juice Clarification. The effect of crude pectinase of the bacterial isolate Chryseobacterium indologenes strain SD was studied for apple/grape juice clarification. The crude enzyme of the selected isolate showed good activities by clarifying the juices as compared to control (Figure 7).

Nowadays, the need of industrially important enzymes has increased rapidly. Pectinase enzyme has taken great attraction in the field of juice clarification and other commercial applications. In this study, Chryseobacterium indologenes strain SD was found as a potential pectinase producer and it is the first report on Chryseobacterium indologenes strain SD. In this investigation, the crude enzyme was found to be slightly alkaline in nature and best active at 40[degrees]C for 40 minutes of incubation. Further studies can be done for complete characterization and purification of the crude enzyme and purified enzymes can be used in various types of fruit juice clarification.

Os autores declaram não haver conflitos de interesse.

The financial support from the Ministry of Science and Technology and University Grant Commission (UGC), Bangladesh, is thankfully acknowledged.

[1] D. B. Pedrolli, A. C. Monteiro, E. Gomes, and E. C. Carmona, "Pectin and pectinases: production, characterization and industrial application of microbial pectinolytic enzymes," The Open Biotechnology Journal, vol. 3, no. 1, pp. 9-18, 2009.

[2] O. A. Oyewole, S. B. Oyeleke, B. E. N. Dauda, and S. Emiade, "Production of Amylase and Protease Enzymes by Aspergillus niger and Penicillium frequestans Isolated from Abattoir Effluent," Journal of Microbiology, vol. 1, não. 5, pp. 174-180, 2011.

[3] F. Stutzenberger, "Pectinase Production," in Encyclopedia of Microbiology, J. Lederberg, Ed., vol. 3, pp. 327-337, Academy press, New York, NY, USA, 1992.

[4] S. Kaur, H. P. Kaur, B. Prasad, and T. Bharti, "Production and Optimization of Pectinase by Bacillus sp. Isolated From Vegetable Waste Soil," Indo American Journal of Pharmaceutical Research, vol. 6, não. 1, pp. 4185-4190, 2016.

[5] I. Alkorta, C. Garbisu, J. M. Llama, and J. L. Serra, "A Review," Process Biochemistry, vol. 17, pp. 35-41, 1982.

[6] K. Prathyusha and V. Suneetha, "Bacterial pectinases and their potent biotechnological application in fruit processing/Juice production industry: A review," Journal of Phytology, vol. 3, no. 6, pp. 16-19, 2011.

[7] R. C. Dubey and D. K. Maheshwari, "Practical Microbiology," in S. Chand and Co. P Ltd, p. 413, ISBN, New Delhi, 2nd edition.

[8] L. K. Janani, G. Kumar, and K. V. Bhaskara Rao, "Production and Optimization of Pectinase from Bacillus sp. MFW7 using Cassava Waste," Asian Journal of Biochemical and Pharmaceutical Research, vol. 1, não. 2, pp. 329-336, 2011.

[9] S. Kumar, G. Stecher, and K. Tamura, "MEGA7: Molecular Evolutionary Genetics Analysis version 70 for bigger datasets," Molecular Biology and Evolution, vol. 33, no. 7, pp. 1870-1874, 2016.

[10] D. R. Kashyap, S. Chandra, A. Kaul, and R. Tewari, "Production, purification, and characterization of pectinase from a Bacillus sp," World Journal of Microbiology & Biotechnology, vol. 16, pp. 277-282, 2000.

[11] N. Nelson, "A photometric adaptation of the Somogyi method for the determination of glucose," The Journal of Biological Chemistry, vol. 153, pp. 375-380, 1944.

[12] M. Somogyi, "Notes on sugar determination," The Journal of Biological Chemistry, vol. 195, no. 1, pp. 19-23, 1952.

[13] D. Silva, E. S. Martins, R. Silva, and E. Gomes, "Pectinase production by Penicillium viridicatum RFC3 by solid state fermentation using agro-industrial by-products," Brazilian Journal of Microbiology, vol. 33, pp. 318-324, 2002.

[14] O. H. Lowry, N. J. Rosebrough, A. L. Farr, and R. J. Randall, "Protein measurement with Folin phenol reagent," The Journal ofBiological Chemistry, vol. 193, pp. 265-275, 1951.

[15] S. A. Mehta, R. Mitali, S. Nilofer, and P Nimisha, "Optimization of physicological parameters for pectinase production from soil isolates and its applications in fruit juice clarification," Journal of Environmental Research and Development, vol. 7, não. 4, pp. 1539-1546, 2013.

[16] R. S. Jayani, S. Saxena, and R. Gupta, "Microbial pectinolytic enzymes: a review," Process Biochemistry, vol. 40, no. 9, pp. 2931-2944, 2005.

[17] R. E. Buchannan and N. E. Gibbson, Bergey's manual of determinative Bacteriology, Williams and Wilkins Co, Baltimore, Maryland, USA, 8th edition, 1974.

[18] N. Saitou and M. Nei, "The neighbor-joining method: a new method for reconstructing phylogenetic trees," Molecular Biology and Evolution, vol. 4, não. 4, pp. 406-425, 1987

[19] J. Felsenstein, "Confidence limits on phylogenies: an approach using the bootstrap," Evolution, vol. 39, pp. 783-791, 1985.

[20] K. Tamura, M. Nei, and S. Kumar, "Prospects for inferring very large phylogenies by using the neighbor-joining method," Proceedings of the National Acadamy of Sciences of the United States of America, vol. 101, não. 30, pp. 11030-11035, 2004.

[21] G. Aaisha and D. Barate, "Isolation and Identification of Pectinolytic Bacteria from Soil Samples of Akola Region, India," International Journal of Current Microbiology and Applied Sciences, vol. 5, não. 1, pp. 514-521, 2016.

[22] A. B. Saanu, "Pectinolytic Activity of Mutagenic Strain of Leuconostoc Mesenteroides Isolated From Orange and Banana Fruit Waste," Journal of Applied Microbiology and Biochemistry, vol. 1, não. 2:7, pp. 1-6, 2017

[23] O. J. Oumer and D. Abate, "Characterization of Pectinase from Bacillus subtilis Strain Btk 27 and Its Potential Application in Removal of Mucilage from Coffee Beans," Enzyme Research, vol. 2017, Article ID 7686904, 7 pages, 2017.

[24] M. H. Nawawi, R. Mohamad, P M. Tahir, and W. Z. Saad, "Extracellular Xylanopectinolytic Enzymes by Bacillus subtilis ADI1 from EFB's Compost," International Scholarly Research Notices, vol. 2017, Article ID 7831954, 7 pages, 2017

[25] S. Prakash, R. Karthik, M. T. Venthan, B. Sridhar, and P. G. Bharath, "Optimization and Production of Pectinase from Bacillus subtilis (mtcc 441) by using Orange Peel as a Substrate," International Journal of Recent Scientific Research, vol. 5, não. 6, pp. 1177-1179, 2014.

[26] R. S. Jayani, S. K. Shukla, and R. Gupta, "Screening of bacterial strains for polygalacturonase activity: its production by bacillus sphaericus (MTCC 7542)," Enzyme Research, vol. 2010, Article ID 306785, 5 pages, 2010.

[27] A. Thakur, R. Pahwa, S. Singh, and R. Gupta, "Production, purification, and characterization of polygalacturonase from mucor circinelloides ITCC 6025," Enzyme Research, vol. 2010, Article ID 170549, 7 pages, 2010.

[28] N. Torimiro and R. E. Okonji, "A comparative study of pectinolytic enzyme production by Bacillus species," African Journal of Biotechnology, vol. 12, não. 46, pp. 6498-6503, 2013.

[29] M. M. C. N. Soares, R. Da Silva, and E. Gomes, "Screening of bacterial strains for pectinolytic activity: Characterization of the polygalacturonase produced by Bacillus sp," Brazilian Journal of Microbiology, vol. 30, não. 4, pp. 299-303, 1999.

[30] I. G. Khan and D. L. Barate, "Effect of various parameters on activity of pectinase enzyme," International Journal of Advanced Research, vol. 4, não. 1, pp. 853-862, 2016.

<ADD> Karabi Roy (iD), Sujan Dey (iD), Md. Kamal Uddin (iD), Rasel Barua, and Md. Towhid Hossain Department of Microbiology, University of Chittagong, Chittagong 4331, Bangladesh </ADD>

Correspondence should be addressed to Sujan Dey [email protected]

Received 21 September 2017 Revised 24 January 2018 Accepted 11 February 2018 Published 21 March 2018

Academic Editor: Denise Freire

Caption: Figure 1: Zone of pectin hydrolysis on YEP agar medium of isolate K6 after 48-hour incubation.

Caption: Figure 2: Phylogenetic tree constructed on the basis of 16S rRNA gene sequences of Chryseobacterium indologenes strain SD with other Chryseobacterium sp. obtained from GenBank database. Their names and respective accession numbers are shown on the tree.

Caption: Figure 3: Effect of temperature on pectinase activity.

Caption: Figure 4: Effect of pH on pectinase activity.

Caption: Figure 5: Effect of reaction time on pectinase activity.

Caption: Figure 6: Effect of substrate (citrus pectin) concentration on pectinase activity.

Caption: Figure 7: Application of pectinase in apple juice (a) and grape juice (b) clarification.


Resultados e discussão

Fungal strains have frequently been reported for the production of industrially important enzymes from waste materials. The hyphal mode of growth enables them to penetrate through the substrate and to utilize fermentable components by elaborating hydrolases. The availability of banana makes its waste, BP, a promising substrate for the fungal fermentation to obtain value-added products. Previously, A. fumigatus was found to have better growth on the banana peels medium when compared to the other fungal strains (Essien et al. 2005). Whereas, the strain MS16 of A. fumigatus reportedly produced cellulase, xylanase, and pectinase on apple peels (Jalis et al. 2014) and other waste materials (Naseeb et al. 2015). Subsequently, the ability of this fungus to produce xylanase and pectinase under submerged and solid-state fermentation of BP is being reported here. Considering the fact that fermentation processes are greatly influenced by environmental conditions and nutritional factors, a comparative study was conducted to investigate the effect of these factors on the production of the enzymes under two different sets of conditions i.e. Smf and SSF.

Submerged fermentation. The studies on the effect of the medium on the enzyme production showed that the maximum activity of xylanase was found in mineral salt medium (MSM), whereas, titers of pectinase were slightly higher in Czapeck dox broth than in MSM (Fig. 1). Therefore, MSM was used in the remaining experiments.

Fig. 1.

Effect of medium along with banana peels (BP) on the pec tinase and xylanase production by A. fumigatus MS16 under submerged fermentation.

When the effect of temperature on pectinase production was studied, it was observed that there wasn’t much variation in the titers of pectinase when the cultivation temperature varied from 25 to 35°C (Fig. 2). However, a drastic decrease in the levels of pectinase was observed when the temperature was adjusted to 40°C. Temperature affected the production of xylanase differently as it was observed that Smf could be carried out at a temperature from 20–40°C without affecting the enzyme yield, though titers of the enzymes were slightly higher at 30 and 35°C. This finding was in agreement with the results obtained by Naseeb et al. (2015).

Figura 2.

Effect of temperature on pectinase and xylanase production under submerged (SmF) and Solid state fermentation (SSF) of banana peels by A. fumigatus MS16.

To investigate the induction of pectinase and xylanase by the corresponding substrate (pectin or xylan), the two substrates were added separately or in combination, in BP containing MSM and the production of both the enzymes was studied. It was noted that pectinase production was enhanced when only pectin or pectin with xylan was added to the MSM + BP (Fig. 3) however, the production was negatively affected if only xylan was added to the MSM + BP. Likewise, xylanase production by MS16 was induced in the presence of xylan supplemented MSM + BP or xylan and pectin containing MSM + BP. Previously, supplementation of pectin and xylan to apple peel powder was found to induce pectinase and xylanase, respectively, under SSF by A. fumigtus MS16 (Jalis et al. 2014).

Fig. 3.

Effect of supplementation of pectin and xylan to banana peels containing medium on the production of pectinase and xylanase from A. fumigatus MS16 under solid-state (SSF) and submerged fermentation (Smf).

The pH value of the medium influences the production of an enzyme by regulating the solubility of the nutrients, the permeability of the cell membrane, and ionization of amino acids and/or proteins. Usually, fungal strains grow better under acidic conditions A. fumigates MS16 did not show any exception, indeed a value of 5 as initial pH of the medium favored the production of pectinase (Fig. 4) and pH 6 spurred xylanase production. The production of extracellular enzyme by A. fumigates under acidic conditions using municipal waste as a substrate (Gautam et al. 2011) and xylanase by a mutated strain of A. niger (Haq et al. 2004) was reported previously.

Fig. 4.

Effect of pH on pectinase and xylanase production from A. fumigatus MS16 under submerged fermentation.

In the submerged fermentation the varying concentrations (0.25–1.6%) of BP were tested to determine the optimal concentration for the production of the enzymes. MS16 produced the highest titers of pectinase in MSM with 1% BP and xylanase in 0.25% BP containing medium (Fig. 5).

Fig. 5.

Effect of banana peels concentration on pectinase and xylanase production from A. fumigatus MS16 under submerged fermentation.

After studying optimum levels of the above-mentioned factors, the enzyme production was studied by taking aliquots intermittently and the optimum incubation period for both the enzymes was determined. The data showed that pectinase production was maximum on day six, thereafter, it decreased slightly, while xylanase production dropped significantly when the incubation period extended from five days (data not shown).

Solid-State Fermentation. The production of pectinase and xylanase was also studied in the absence of water, i.e. under SSF. In this case, the optimum levels of the factors were different than was observed for Smf. For instance, a cultivation temperature of 25°C appeared as the most suitable temperature when the production of pectinase was studied under SSF (Fig. 2). Earlier, pectinase production by Fusarium sp. was reportedly found better at a lower temperature (Sohail et al. 2009) while A. niger also produced pectinase under similar conditions (Haq et al. 2004). The production of the enzyme under SSF appeared as sensitive to temperature as the levels of xylanase declined by 50% when the temperature was increased from 35 to 40°C. It can be attributed to poor control of heat transfer under SSF that usually results in an increase in the temperature inside the substrate and hence the enzyme can be denatured or organism’s growth can be restricted. Palaniswamy et al. (2012) also observed the decrease in xylanase production by Aspergillus sp. in rice bran containing medium at higher temperatures.

In SSF, the xylanase production increased with the supplementation of 0.5% xylan alone or with pectin, while it decreased when the pectin was supplemented without xylan (Fig. 3). The supplementation of pectin and/or xylan did not exert the significant effect on the pectinase production by MS16. In their studies, Rehman et al. (2014) reported about the indifferent pattern of pectinase production upon supplementation of pectin to BP under SSF by a fungal co-culture.

The moisture content is one of the important factors for solid-state fermentation but it did not affect the activity of xylanase it was almost the same but the pectinase activity was maximal at 65% moisture content (Fig. 6) that corroborated with the findings of Padma et al. (2012) where 65% moisture was optimal to obtain the highest levels of polygalactouronase by SSF of BP.

Fig. 6.

Effect of moisture content on pectinase and xylanase production under solid-state fermentation of banana peels.

Finally, the production of the enzyme was studied under optimum conditions for a period of 5–7 days and enzyme activity was assayed. The maximum pectinase was produced in five days of incubation while xylanase production was the highest after seven days of incubation (data not shown).

Factors affecting enzyme activities. The optimum temperatures and pH for the activities of xylanase and pectinase produced under Smf and SSF were also determined. The pectinase activity produced under Smf was found to be the highest at 45°C (Fig. 7) while the enzyme produced under SSF exhibited optimal activity at 60°C. Likewise, xylanase activity produced under SSF had higher temperature optima of 55–60°C compared to the enzyme produced under smf that was optimally active at 50°C. However, the extraction methods to obtain crude enzyme from Smf and SSF differed greatly and might have influenced the stability of the enzymes. Nonetheless, both the enzymes were more heat-stable as compared to the cellulase (Toptar 40°C) produced on BP (Kiranmayi et al. 2011).

Fig. 7.

Effect of temperature on pectinase and xylanase activities produced under solid-state (SSF) and submerged fermentation (Smf).

The studies on the effect of pH on the enzyme activity showed that pectinase and xylanase were catalytically most active at pH 5.0 and 5.5 (Fig. 8), respectively, and this property remained unaffected when the production method was changed from Smf to SSF. Generally, fungal enzymes work well under acidic conditions. For instance, Kiranmayi et al. (2011) reported that a value of 6.0 as the most suitable pH for cellulase activity from A. niger on BP as a substrate.

Fig. 8.

Effect of pH on pectinase and xylanase activity produced from A. fumigatus MS16 under solid-state (SSF) and submerged fermentation (Smf).


Questions:

1. What was the optimal temperature for catalase activity? Was the prediction you made correct?

2. What happened to catalase activity at 80˚C? Based on what you know about protein structure, how would you explain that result?

3. What was the optimal pH for catalase activity? Was the prediction you made correct?

4. Can you identify any potential problems or sources of error with the experimental design? How could it be improved?

5. What is the substrate for catalase? What are the products of the reaction?

6. How is the substrate of an enzyme different from the active site?

7. The pH in the stomach is pH 2.0. What do you think the optimum pH is for pepsin, an enzyme that is secreted in the stomach?


Assista o vídeo: What is the Purpose of Pectic Enzyme? (Janeiro 2022).