Em formação

Como são adicionados os primeiros telômeros?


Aqui está uma imagem da telomerase adicionando telomerase.

Como podemos ver, a telomerase meio que se liga a um pouco da "extremidade lateral 3 'existente do telômero" - é quase meio a meio.

Minha pergunta é: de onde veio esse telômero existente? E o telômero antes disso?

Essencialmente, os telômeros devem ter começou de algum ponto no cromossomo / DNA, mas como estavam Essa telômeros adicionados se a telomerase tem uma sequência de RNA predefinida que usa para se ligar a bases de nucleotídeos específicas? Nosso DNA humano coincidentemente termina com TTAGGG também ou algo assim?


Os telômeros são mantidos pela telomerase (em certos tipos de células, não em todos) a cada replicação. Então, a resposta para suas perguntas "de onde veio aquele telômero existente? E o telômero anterior?" é: "porque já havia um telômero para estender no final desse cromossomo".

Suas perguntas se resumem a "como os telômeros apareceram em primeiro lugar?" (porque uma vez que os telômeros e um mecanismo de manutenção tenham sido estabelecidos, eles simplesmente permanecerão, a menos que alguma grande catástrofe genômica aconteça), e esta é uma questão difícil. Como Whitney apontou nos comentários de sua pergunta, algumas hipóteses sobre a origem dos telômeros são discutidas neste artigo. Interessantemente, Drosófila não tem telomerase e mantém os telômeros por um mecanismo de transposição. De alguma forma, esta é uma pista sobre como os telômeros apareceram: Drosófila telômeros podem ser um intermediário entre os cromossomos circulares e a manutenção de cromossomos lineares baseada na telomerase.

Este é um tópico complicado, mas a literatura científica sobre o aparecimento de telômeros é fascinante. Algumas bactérias (Borrelia e Streptomyces taxa) têm cromossomos lineares, mas mecanismos de manutenção que nada têm a ver com transposição ou telomerase.

Aqui estão algumas referências:

  • Drosófila: https://doi.org/10.3389/fonc.2013.00112
  • Borrelia: https://doi.org/10.1146/annurev.micro.112408.134037
  • Streptomyces: http://link.springer.com/chapter/10.1007/7171_2007_090

Se você sabe ler francês, encontrará mais informações na introdução da minha tese de doutorado.


O recente reconhecimento de defeitos genéticos em telômeros e reparo de telômeros em várias doenças humanas tem implicações práticas para hematologistas e oncologistas e seus pacientes consequências para futuras pesquisas clínicas em hematologia e outras subespecialidades e até mesmo importância na interpretação de experimentos animais envolvendo propagação de células. As doenças teloméricas incluem insuficiência medular constitucional como disceratose congênita, alguma anemia aplástica aparentemente adquirida, mielodisplasia e leucemia mieloide aguda, fibrose pulmonar e hiperplasia nodular regenerativa hepática e cirrose. O atrito acelerado dos telômeros é uma provável fisiopatologia do câncer decorrente de inflamação crônica. A telomerase pode ser modulada por hormônios sexuais, o que pode explicar a atividade dos andrógenos na insuficiência medular. A medição do comprimento dos telômeros de leucócitos do sangue periférico é um ensaio clínico simples de triagem. A detecção de uma mutação em um paciente tem implicações para a terapia, prognóstico, monitoramento e aconselhamento genético. Para pesquisas em hematologia e oncologia, a biologia dos telômeros pode ser avaliada como um risco para malignidades secundárias e na doença do enxerto contra o hospedeiro, para a progressão em uma variedade de cânceres do sangue e como potencialmente modificável por estratégias de reposição hormonal.

Os telômeros são componentes essenciais dos cromossomos lineares, mas sua existência foi postulada anos antes da elucidação da dupla hélice. No final dos anos 1930, Hermann Muller e Barbara McClintock notaram independentemente que as extremidades dos cromossomos (denominadas "telômeros" ou "extremidades naturais") não tinham a "aderência" das extremidades cromossômicas quebradas. Décadas mais tarde, após a descoberta da estrutura do DNA, Alexey Olovnikov implicou telômeros no "limite de Hayflick" da duplicação celular ainda mais, ele percebeu que na replicação semiconservativa do DNA, a réplica seria sempre mais curta do que o modelo, eventualmente produzindo extremamente cromossomos curtos e células senescentes sua 'teoria da marginotomia' levantou a hipótese de que os telômeros tamponariam a perda genética com sucessivas divisões mitóticas e que o encurtamento dos telômeros poderia explicar muitos distúrbios relacionados ao envelhecimento ”. James Watson concluiu de forma semelhante, a partir de observações da replicação do fago de DNA T7, que "não havia uma maneira simples de o crescimento 3′-5 ′ atingir a extremidade 3 ′ de seu modelo." No início dos anos 1980, Elizabeth Blackburn e seus associados resolveram a estrutura dos telômeros e descobriram uma enzima, a telomerase, capaz de conter a erosão dos telômeros pela síntese de DNA por meio da transcrição reversa.

O leitor deve consultar nossa revisão recente, mais abrangente e ilustrada da biologia e doenças dos telômeros. 1


A estrutura dos telômeros

Na maioria dos organismos eucarióticos, incluindo protozoários, fungos, insetos, plantas superiores e mamíferos, os terminais cromossômicos são compostos de repetições curtas de sequência de DNA. Geralmente são ricos em G e são mantidos pela telomerase (ver [14,15] para revisões). Existem muitas exceções a esta regra geral, incluindo Drosófila [7,8,9,10] e outros insetos, notavelmente Chironomus (midge) espécie [16,17,18] e o mosquito Anopheles gambiae [19], bem como plantas do gênero relacionadas à cebola Allium [20]. A maioria dessas exceções tem uma matriz complexa de repetição em tandem em suas extremidades [16,17,18,19,20]. Drosófila elementos retrotransponíveis não LTR HeT-A e / ou TART [7,8,9,10] podem ser únicos a este respeito. Praticamente todos os eucariotos, incluindo Drosófila e as outras 'exceções' mencionadas acima, têm repetições complexas perto do terminal do cromossomo, chamadas sequências associadas a telômeros (TASs) ou sequências de repetições subteloméricas (STRs) (ver [21] para revisão). Muitos também têm elementos transponíveis próximos ou mesmo incorporados nas repetições mantidas pela telomerase, tornando-os um tanto semelhantes a Drosófila (veja a Figura 1). O fermento Saccharomyces cerevisiae tem um transposon LTR específico de subtelômero, Ty5 [22], bem como um grande quadro de leitura aberta contendo um elemento chamado Y 'embutido nas repetições do telômero [23,24]. A alga Clorela possui um elemento telomérico denominado Zepp [25,26]. A mariposa da seda Bombyx mori tem dois elementos retrotransponíveis não-LTR teloméricos chamados SART e TRAS [27,28], que não são diferentes dos elementos HeT-A e TART de Drosófila. Recentemente, três famílias de transposões no parasita intestinal protozoário Giardia lamblia foram descritos, dois dos quais são telômeros específicos [29]. Drosophila melanogaster e alguns de seus parentes, como Drosophila yakuba [30], podem ser únicos em seu uso de retrotransposons teloméricos na extremidade dos cromossomos, mas eles não estão sozinhos em ter elementos teloméricos. Além disso, nem todos Drosófila espécies aparentemente têm estes retroelementos: os mais distantemente relacionados Drosophila virilis grupo aparentemente tem uma matriz complexa de repetições tandem análogas às encontradas em Chironomus e Allium [31].

Estruturas de telômeros, ilustrando a miríade de mecanismos para manter as extremidades dos cromossomos. (uma) A maioria dos organismos tem a estrutura de extremidade cromossômica genérica que consiste em repetições de telômeros ricos em G (TRs) que são mantidas pela telomerase com sequências associadas a telômeros adjacentes (TASs), também chamadas de sequências de repetição subtelomérica (STRs) (ver [21,63] para Reveja). (b) Em alguns organismos, como o fermento S. cerevisiae [23], a mariposa Bombyx mori [27,28], a alga Clorela [25,26], e protozoário Giardia lamblia [29], existem elementos retrotransponíveis (setas verdes) embutidos em ou perto das repetições do telômero. (c) Em alguns organismos, como o mosquito Anopheles gambiae [19], a cebola Allium cepa [20], o midge Chironomus [16,17,18,64], e a mosca da fruta Drosophila virilis [31], as extremidades do cromossomo consistem em repetições em tandem complexas que não são mantidas pela telomerase. (d) Drosophila melanogaster e parentes próximos têm apenas elementos retrotransponíveis em suas extremidades [7,8,9,10].


Conteúdo

No início dos anos 1970, o teórico russo Alexei Olovnikov reconheceu pela primeira vez que os cromossomos não podiam replicar completamente suas extremidades. Com base nisso, e para acomodar a ideia de Leonard Hayflick de divisão celular somática limitada, Olovnikov sugeriu que as sequências de DNA são perdidas toda vez que uma célula se replica até que a perda atinja um nível crítico, ponto no qual termina a divisão celular. [1]

Em 1975-1977, Elizabeth Blackburn, trabalhando como pós-doutoranda na Universidade de Yale com Joseph G. Gall, descobriu a natureza incomum dos telômeros, com suas simples sequências de DNA repetidas compondo as extremidades dos cromossomos. [2] Blackburn, Carol Greider e Jack Szostak receberam o Prêmio Nobel de Fisiologia ou Medicina de 2009 pela descoberta de como os cromossomos são protegidos por telômeros e a enzima telomerase. [3]

Em 1983, Barbara McClintock, uma citogenética americana e a primeira mulher a receber um Prêmio Nobel de Fisiologia ou Medicina não compartilhado, recebeu o Prêmio Nobel por observar que os cromossomos sem partes finais tornaram-se "pegajosos" e hipotetizou a existência de uma estrutura especial no ponta do cromossomo que manteria a estabilidade do cromossomo. [4]

Fim do problema de replicação Editar

Durante a replicação do DNA, a DNA polimerase não consegue replicar as sequências presentes nas extremidades 3 '. Isso é uma consequência de seu modo unidirecional de síntese de DNA: ele só pode anexar novos nucleotídeos a uma extremidade 3 'existente (ou seja, a síntese progride em 5'-3') e, portanto, requer um primer para iniciar a replicação. Na fita principal (orientada 5'-3 'dentro do garfo de replicação), a DNA-polimerase se replica continuamente desde o ponto de iniciação até o final da fita com o primer (feito de RNA) sendo então excisado e substituído por DNA. A fita retardada, no entanto, é orientada 3'-5 'em relação à bifurcação de replicação, de modo que a replicação contínua por DNA-polimerase é impossível, o que requer replicação descontínua envolvendo a síntese repetida de iniciadores mais 5' do local de iniciação (ver lagging replicação de fita). O último iniciador a estar envolvido na replicação da fita retardada fica próximo à extremidade 3 'do molde (correspondendo à potencial extremidade 5' da fita retardada). Originalmente, acreditava-se que o último primer ficaria bem no final do molde, portanto, uma vez removida, a DNA-polimerase que substitui os primers por DNA (DNA-Pol δ em eucariotos) [nota 1] seria incapaz de sintetizar o "DNA de substituição" da extremidade 5 'da fita retardada de modo que os nucleotídeos molde previamente emparelhados com o último iniciador não seriam replicados. [5] Desde então, foi questionado se o último iniciador de fita retardada é colocado exatamente na extremidade 3 'do molde e foi demonstrado que é bastante sintetizado a uma distância de cerca de 70-100 nucleotídeos, o que é consistente com a descoberta que o DNA em cultura de células humanas é reduzido em 50-100 pares de bases por divisão celular. [6]

Se as sequências de codificação forem degradadas neste processo, o código genético potencialmente vital será perdido. Os telômeros são sequências repetitivas não codificantes localizadas nas extremidades dos cromossomos lineares para atuar como buffers para as sequências codificantes posteriores. Eles "protegem" as sequências finais e são progressivamente degradados no processo de replicação do DNA.

O "problema de replicação de extremidades" é exclusivo dos cromossomos lineares, pois os cromossomos circulares não têm extremidades fora do alcance das DNA-polimerases. A maioria dos procariontes, dependendo de cromossomos circulares, não possui telômeros. [7] Uma pequena fração de cromossomos bacterianos (como aqueles em Streptomyces, Agrobacterium, e Borrelia), no entanto, são lineares e possuem telômeros, que são muito diferentes daqueles dos cromossomos eucarióticos em estrutura e função. As estruturas conhecidas dos telômeros bacterianos assumem a forma de proteínas ligadas às extremidades dos cromossomos lineares, ou loops em gancho de DNA de fita simples nas extremidades dos cromossomos lineares. [8]

Telômero termina e abrigo em Editar

Na extremidade 3 'do telômero há uma saliência de 300 pares de bases que pode invadir a porção de fita dupla do telômero, formando uma estrutura conhecida como um T-loop. Esse laço é análogo a um nó, que estabiliza o telômero e evita que as extremidades do telômero sejam reconhecidas como pontos de interrupção pelo mecanismo de reparo do DNA. Caso ocorra união de extremidade não homóloga nas extremidades teloméricas, resultaria em fusão cromossômica. O T-loop é mantido por várias proteínas, conhecidas coletivamente como o complexo shelterin. Em humanos, o complexo shelterin consiste em seis proteínas identificadas como TRF1, TRF2, TIN2, POT1, TPP1 e RAP1. [9] Em muitas espécies, as repetições de sequência são enriquecidas em guanina, por ex. TTAGGG em vertebrados, [10] que permite a formação de G-quadruplexes, uma conformação especial de DNA envolvendo pareamento de bases não Watson-Crick. Existem diferentes subtipos, dependendo do envolvimento do DNA de fita simples ou dupla, entre outras coisas. Há evidências de que a saliência 3 'nos ciliados (que possuem repetições teloméricas semelhantes às encontradas nos vertebrados) para formar esses quadruplexes G que os acomodam, ao invés de um T-loop. Os G-quadruplexes representam um obstáculo para enzimas como DNA-polimerases e, portanto, acredita-se que estejam envolvidos na regulação da replicação e da transcrição. [11]

Edição de telomerase

Muitos organismos possuem uma enzima chamada telomerase, que realiza a tarefa de adicionar sequências repetitivas de nucleotídeos às extremidades do DNA. A telomerase "repõe" a "tampa" do telômero. Na maioria dos organismos eucarióticos multicelulares, a telomerase é ativa apenas nas células germinativas, alguns tipos de células-tronco, como as células-tronco embrionárias, e certos glóbulos brancos. A telomerase pode ser reativada e os telômeros retornam ao estado embrionário por transferência nuclear de células somáticas. [12] O encurtamento constante dos telômeros com cada replicação em células somáticas (do corpo) pode ter um papel na senescência [13] e na prevenção do câncer. [14] [15] Isso ocorre porque os telômeros agem como uma espécie de "fusível" de retardo, eventualmente acabando após um certo número de divisões celulares e resultando na eventual perda de informações genéticas vitais do cromossomo da célula com futuras divisões . [16]

Edição de comprimento

O comprimento do telômero varia muito entre as espécies, de aproximadamente 300 pares de bases em leveduras [17] a muitos quilobases em humanos, e geralmente é composto de matrizes de repetições de seis a oito pares de bases ricas em guanina. Os telômeros eucarióticos normalmente terminam com saliência 3 ′ de DNA de fita simples, que é essencial para a manutenção e cobertura dos telômeros. Várias proteínas que se ligam ao DNA dos telômeros de fita simples e dupla foram identificadas. [18] Estes funcionam tanto na manutenção quanto na proteção dos telômeros. Os telômeros formam grandes estruturas de loop chamadas de loops de telômero ou T-loops. Aqui, o DNA de fita simples se enrola em um longo círculo, estabilizado por proteínas de ligação aos telômeros. [19] Bem no final do T-loop, o DNA do telômero de fita simples é mantido em uma região de DNA de fita dupla pela fita do telômero que rompe o DNA de dupla hélice e emparelhamento de base a uma das duas fitas. Essa estrutura de fita tripla é chamada de loop de deslocamento ou D-loop. [20]

Papel no ciclo celular Editar

O encurtamento do telômero em humanos pode induzir a senescência replicativa, que bloqueia a divisão celular. Este mecanismo parece prevenir a instabilidade genômica e o desenvolvimento de câncer em células humanas envelhecidas, limitando o número de divisões celulares. No entanto, os telômeros encurtados prejudicam a função imunológica, o que também pode aumentar a suscetibilidade ao câncer. [21] Se os telômeros se tornam muito curtos, eles têm o potencial de se desdobrar a partir de sua estrutura fechada presumida. A célula pode detectar esse desbloqueio como dano ao DNA e então parar de crescer, entrar na velhice celular (senescência) ou começar a autodestruição celular programada (apoptose), dependendo da origem genética da célula (status de p53). Os telômeros destapados também resultam em fusões cromossômicas. Como esse dano não pode ser reparado em células somáticas normais, a célula pode até entrar em apoptose. Muitas doenças relacionadas ao envelhecimento estão associadas a telômeros encurtados. Os órgãos se deterioram à medida que mais e mais células morrem ou entram na senescência celular.

Dano oxidativo Editar

Além do problema de replicação final, estudos in vitro mostraram que os telômeros acumulam danos devido ao estresse oxidativo e que o dano ao DNA mediado pelo estresse oxidativo tem uma grande influência no encurtamento dos telômeros in vivo. Há uma infinidade de maneiras pelas quais o estresse oxidativo, mediado por espécies reativas de oxigênio (ROS), pode levar a danos no DNA; no entanto, ainda não está claro se a taxa elevada nos telômeros é causada por sua suscetibilidade inerente ou uma atividade diminuída do DNA sistemas de reparo nessas regiões. [22] Apesar da ampla concordância das descobertas, falhas generalizadas em relação à medição e amostragem foram apontadas, por exemplo, uma espécie suspeita e dependência de tecido de dano oxidativo aos telômeros é considerada insuficientemente contabilizada. [23] Estudos de base populacional indicaram uma interação entre a ingestão de antioxidantes e o comprimento dos telômeros. No Long Island Breast Cancer Study Project (LIBCSP), os autores encontraram um aumento moderado no risco de câncer de mama entre mulheres com telômeros mais curtos e menor ingestão dietética de beta-caroteno, vitamina C ou E. [24]. Esses resultados [25] sugerem que o risco de câncer devido ao encurtamento dos telômeros pode interagir com outros mecanismos de dano ao DNA, especificamente o estresse oxidativo.

Associação com envelhecimento Editar

O encurtamento do telômero está associado ao envelhecimento, mortalidade e doenças relacionadas ao envelhecimento. O envelhecimento normal está associado ao encurtamento dos telômeros em humanos e camundongos, e estudos em modelos animais geneticamente modificados sugerem ligações causais entre a erosão dos telômeros e o envelhecimento. [26] No entanto, não se sabe se os telômeros curtos são apenas um sintoma da senescência ou se eles próprios contribuem para a progressão do processo de envelhecimento. [27]

A idade do pai desempenha um papel no comprimento dos telômeros da criança, o que tem implicações evolutivas. Embora os telômeros dos leucócitos diminuam com a idade, os telômeros dos espermatozoides aumentam com a idade. Teoriza-se que telômeros mais curtos impõem custos de energia mais baixos (devido a menos replicação), mas também têm custos relacionados ao sistema imunológico e outros custos relacionados ao envelhecimento e doenças, portanto, o efeito da idade paterna no comprimento dos telômeros pode ser uma adaptação para aumentar as chances de que a criança será adequada para o ambiente em que nasceram. [28] [29]

Efeito potencial do estresse psicológico Editar

As meta-análises descobriram que o aumento do estresse psicológico percebido estava associado a uma pequena diminuição no comprimento dos telômeros - mas que essas associações atenuaram para nenhuma associação significativa quando contabilizando o viés de publicação. A literatura sobre telômeros como biomarcadores integrativos de exposição ao estresse e adversidade é dominada por estudos transversais e correlacionais, o que torna a interpretação causal problemática. [25] [30] Uma revisão de 2020 argumentou que a relação entre o estresse psicossocial e o comprimento dos telômeros parece mais forte para o estresse experimentado no útero ou no início da vida. [31]

O fenômeno da divisão celular limitada foi observado pela primeira vez por Leonard Hayflick e agora é conhecido como limite de Hayflick. [32] [33] Descobertas significativas foram subsequentemente feitas por um grupo de cientistas organizado na Geron Corporation pelo fundador da Geron, Michael D. West, que ligou o encurtamento do telômero ao limite de Hayflick. [34] A clonagem do componente catalítico da telomerase permitiu experimentos para testar se a expressão da telomerase em níveis suficientes para prevenir o encurtamento do telômero era capaz de imortalizar células humanas. A telomerase foi demonstrada em uma publicação de 1998 em Ciência ser capaz de estender a vida das células, e agora é bem conhecido como capaz de imortalizar células somáticas humanas. [35]

Está se tornando aparente que reverter o encurtamento dos telômeros por meio da ativação temporária da telomerase pode ser um meio potente de retardar o envelhecimento. A razão pela qual isso aumentaria a vida humana é porque aumentaria o limite de Hayflick. Três rotas têm sido propostas para reverter o encurtamento dos telômeros: medicamentos, terapia gênica ou supressão metabólica, o chamado torpor / hibernação. Até agora, essas idéias não foram comprovadas em humanos, mas foi demonstrado que o encurtamento dos telômeros é revertido na hibernação e o envelhecimento é retardado (Turbill, et al. 2012 e 2013) e que a hibernação prolonga o tempo de vida (Lyman et al. 1981). Também foi demonstrado que a extensão do telômero reverteu com sucesso alguns sinais de envelhecimento em ratos de laboratório [36] [37] e nas espécies de vermes nematódeos Caenorhabditis elegans. [38] Foi levantada a hipótese de que telômeros mais longos e especialmente a ativação da telomerase podem causar aumento do câncer (por exemplo, Weinstein e Ciszek, 2002 [39]). No entanto, telômeros mais longos também podem proteger contra o câncer, porque telômeros curtos estão associados ao câncer. Também foi sugerido que telômeros mais longos podem causar aumento no consumo de energia. [21]

As técnicas para estender os telômeros podem ser úteis para a engenharia de tecidos, porque podem permitir que células de mamíferos saudáveis ​​e não cancerosas sejam cultivadas em quantidades grandes o suficiente para serem materiais de engenharia para reparos biomédicos.

Dois estudos com aves marinhas de vida longa demonstram que o papel dos telômeros está longe de ser compreendido. Em 2003, os cientistas observaram que os telômeros do petrel da tempestade de Leach (Oceanodroma leucorhoa) parecem aumentar com a idade cronológica, o primeiro exemplo observado de tal comportamento dos telômeros. [40] Em 2006, Juola et al. [41] relataram que em outra espécie de ave marinha de longa vida não relacionada, a grande fragata (Fregata menor), o comprimento do telômero diminuiu até pelo menos c. 40 anos de idade (ou seja, provavelmente ao longo de toda a vida), mas a velocidade de diminuição diminuiu maciçamente com o aumento da idade, e as taxas de diminuição do comprimento dos telômeros variaram fortemente entre as aves individuais. Eles concluíram que nesta espécie (e provavelmente nas fragatas e seus parentes em geral), o comprimento dos telômeros não poderia ser usado para determinar a idade de uma ave suficientemente bem. Assim, parece que há muito mais variação no comportamento do comprimento dos telômeros do que inicialmente se acreditava.

Além disso, Gomes et al. descobriram, em um estudo da biologia comparativa de telômeros de mamíferos, que o comprimento dos telômeros de diferentes espécies de mamíferos se correlaciona inversamente, ao invés de diretamente, com o tempo de vida, e concluíram que a contribuição do comprimento dos telômeros para o tempo de vida permanece controversa. [42] Harris et al. encontraram poucas evidências de que, em humanos, o comprimento dos telômeros é um biomarcador significativo do envelhecimento normal no que diz respeito a habilidades cognitivas e físicas importantes. [43] Gilley e Blackburn testaram se a senescência celular no paramécio é causada pelo encurtamento dos telômeros e descobriram que os telômeros não eram encurtados durante a senescência. [44]

Seqüências de nucleotídeos telômeros conhecidas e atualizadas estão listadas no site do banco de dados da Telomerase.

Algumas sequências de nucleotídeos de telômeros conhecidas
Grupo Organismo Repetição telomérica (5 'a 3' em direção ao final)
Vertebrados Humano, rato, Xenopus TTAGGG
Fungos filamentosos Neurospora crassa TTAGGG
Moldes viscosos Physarum, Didymium TTAGGG
Dictyostelium AG (1-8)
Protozoários cinetoplastídeos Trypanosoma, Crithidia TTAGGG
Protozoários ciliados Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG (T / G)
Oxytricha, Estiloníquia, Euplotes TTTTGGGG
Protozoários apicomplexanos Plasmodium TTAGGG (T / C)
Plantas superiores Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG [45]
Allium CTCGGTTATGGG [46]
Algas verdes Chlamydomonas TTTTAGGG
Insetos Bombyx mori TTAGG
Lombrigas Ascaris lumbricoides TTAGGC
Leveduras de Fissão Schizosaccharomyces pombe TTAC (A) (C) G (1-8)
Leveduras de brotamento Saccharomyces cerevisiae TGTGGGTGTGGTG (do modelo de RNA)
ou G (2-3) (TG) (1-6) T (consenso)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA [C / A] GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Os telômeros são essenciais para manter a integridade genômica e podem ser fatores para doenças relacionadas à idade. [47] Estudos laboratoriais mostram que a disfunção ou encurtamento dos telômeros é comumente adquirida devido ao processo de envelhecimento celular e desenvolvimento do tumor. [47] [48] Telômeros curtos podem causar instabilidade genômica, perda de cromossomos e formação de translocações e telômeros não recíprocos nas células tumorais e suas lesões precursoras são significativamente mais curtas do que o tecido normal circundante. [49] [50]

Estudos observacionais encontraram telômeros encurtados em muitos tipos de cânceres experimentais. [51] Além disso, descobriu-se que pessoas com câncer possuem telômeros de leucócitos mais curtos do que controles saudáveis. [52] Metanálises recentes sugerem aumento de 1,4 a 3,0 vezes no risco de câncer para aqueles com telômeros mais curtos vs. mais longos. [53] [54] No entanto, o aumento do risco varia por idade, sexo, tipo de tumor e diferenças nos fatores de estilo de vida. [51]

Diversas técnicas são atualmente empregadas para avaliar o comprimento médio dos telômeros em células eucarióticas. Um método é o Southern Blot Terminal Restriction Fragment (TRF). [55] [56] Um ensaio de PCR em tempo real para o comprimento do telômero envolve a determinação da razão Telômero-para-gene de cópia única (T / S), que é demonstrado ser proporcional ao comprimento médio do telômero em uma célula. [57]

Ferramentas também foram desenvolvidas para estimar o comprimento do telômero de experimentos de sequenciamento do genoma completo (WGS). Entre estes estão TelSeq, [58] telomereCat [59] e telomereHunter. [60] A estimativa de comprimento do WGS normalmente funciona diferenciando leituras de sequenciamento de telômeros e, em seguida, inferindo o comprimento do telômero que produziu esse número de leituras. Foi demonstrado que esses métodos se correlacionam com métodos preexistentes de estimativa, como PCR e TRF. O Flow-FISH é usado para quantificar o comprimento dos telômeros nos leucócitos humanos. Um método semiautomático para medir o comprimento médio dos telômeros com Flow FISH foi publicado na Nature Protocols em 2006. [61]

Embora várias empresas ofereçam serviços de medição do comprimento dos telômeros, a utilidade dessas medições para uso clínico ou pessoal generalizado tem sido questionada. [62] [63] A vencedora do Prêmio Nobel Elizabeth Blackburn, que foi cofundadora de uma empresa, promoveu a utilidade clínica das medidas de comprimento dos telômeros. [64]

A maioria das pesquisas sobre o comprimento e a regulação dos telômeros, e sua relação com o câncer e o envelhecimento, foi realizada em mamíferos, especialmente humanos, que têm pouca ou nenhuma produção de telomerase somática. Os ectotérmicos são significativamente mais prováveis ​​do que os endotérmicos de apresentar variação na expressão da telomerase somática. Por exemplo, em muitos peixes, a telomerase ocorre em todo o corpo (e associada a isso, o comprimento do telômero é aproximadamente o mesmo em todo o seu tecido). Estudos sobre ectotérmicos e outros organismos não mamíferos mostram que não existe um único modelo universal de erosão dos telômeros. Em vez disso, há uma ampla variação na dinâmica relevante em Metazoa, e mesmo dentro de grupos taxonômicos menores, esses padrões parecem diversos. Devido aos diferentes cronogramas reprodutivos de alguns ectotérmicos, a seleção de doenças é relevante para uma fração muito maior da vida dessas criaturas do que para os mamíferos, então o comprimento dos telômeros na primeira e na terceira idade e suas possíveis ligações com o câncer parecem especialmente importante nessas espécies do ponto de vista da teoria da história de vida. [65]


RESULTADOS

Os telômeros mais curtos se colocalizam com os focos γH2AX / 53BP1

Usamos a hibridização quantitativa in situ para identificar os telômeros mais curtos em fibroblastos de prepúcio BJ quase senescentes. Vários estudos (Londono-Vallejo et al., 2001 Baird et al., 2003 der-Sarkissian et al., 2004) demonstraram que o comprimento dos telômeros em cromossomos homólogos pode ser diferente. Em vez de medir a força do sinal do telômero, que forneceria a média de ambos os homólogos, identificamos os telômeros mais curtos como aqueles sem um sinal detectável. Apenas telômeros sem sinal em ambas as cromátides quando hibridizados em série com ambos (TTAGGG)4 e (CCCTAA)4 as sondas foram pontuadas como extremidades sem sinal. Os cromossomos foram então digitalizados com um programa de hibridização genômica comparativa (Figura 1A), a fim de identificar as extremidades sem um sinal detectável. Nenhuma extremidade livre de sinal foi encontrada em qualquer telômero em fibroblastos BJ jovens (PD 15, 59 metáfases, dados não publicados). No entanto, em células BJ quase senescentes (PD 84), apenas 10% das metáfases não tinham extremidades sem sinal, enquanto 6% das metáfases tinham uma, 75% tinham 2–3 e 9% tinham 4–5 sem sinais termina. A Figura 1B mostra a distribuição de telômeros muito curtos (% de metáfases exibindo uma extremidade livre de sinal em cada extremidade do cromossomo) para 403 metáfases em PD84, aproximadamente três duplicações antes da senescência. As extremidades do cromossomo 6p e 21p eram as mais curtas, e 80% de todas as extremidades sem sinal podem ser explicadas pelos 10 telômeros mais curtos.

Embora a disfunção do telômero através da remoção de uma proteína telomérica possa induzir focos de dano ao DNA em células de mamíferos (Takai et al., 2003), e γH2AX foi encontrado perto de telômeros em células senescentes por análise de imunoprecipitação da cromatina (d'Adda di Fagagna et al., 2003), a associação específica dos telômeros mais curtos em células senescentes humanas com esses focos não foi demonstrada. Em nosso BJ quase senescente, 79% das 2.000 células de interfase analisadas continham focos de dano no DNA γH2AX / 53BP1, e a grande maioria delas (80%) tinha apenas um ou dois focos. Obtivemos BACs dentro de 100 kb de três das extremidades curtas do telômero (6p [41% extremidades sem sinal], 17q [11,7% extremidades sem sinal] e 9q [7,7% extremidades sem sinal]), duas das extremidades tendo muito telômeros mais longos (7q [0,2% das extremidades sem sinal] e 17p [0% das extremidades sem sinal]), e um que tinha 62 Mb do telômero (9q21).

Estas sondas foram hibridizadas em série com células após a primeira identificação de focos de dano de DNA por coloração com γH2AX / 53BP1. A Figura 2A mostra um exemplo de co-localização de focos de dano de DNA com as extremidades do telômero mais curtas, mas não mais longas, ou sinais internos. A Figura 2B mostra que a frequência de colocalização se aproxima da frequência das extremidades sem sinal mostradas na Figura 1B, com apenas níveis de fundo para as sondas internas e de telômero mais longo. Muitas células exibiram mais de um telômero curto co-localizando com focos, frequentemente com o mesmo foco γH2AX / 53BP1 (Figura 2, A e C). Por exemplo, cerca de um sexto das células mostrando co-localização de 6ptel com focos também mostraram co-localização de 9qtel (Figura 2C).

Figura 2. Colocalização de telômeros curtos com focos γH2AX / 53BP1 na senescência. (A) As células BJ em PD 83 foram primeiro coradas com γH2AX / 53BP1 e, em seguida, hibridizadas em série em pares para quatro sondas BAC diferentes, as sondas para 6pter (41% das extremidades sem sinal), 9qter (7,7% das extremidades sem sinal), e 7qter (extremidades sem sinal de 0,2%) estavam dentro de 100 kb do telômero, enquanto que para 9q21 estava a 62 Mb do telômero. Setas coloridas destacam a posição dos sinais BAC pequenos, mas intensos. A mesma célula aparece em todos os três painéis e mostra a co-localização de 6pter (meio) e 9qter (direita) para o mesmo foco γH2AX / 53BP1 (esquerdo, sobreposto digitalmente nas outras duas imagens). (B) A frequência de co-localização com marcadores de focos de dano ao DNA. As extremidades com telômeros mais curtos (6pter, 17qter e 9qter), mas não as extremidades com telômeros mais longos (7qter e 17pter) ou o locus interno (9q21) mostraram colocalização frequente com marcadores de focos de dano de DNA. Os dados são de pelo menos 900 focos de dano ao DNA por BAC em três lâminas, ± SD entre as lâminas. The % colocalization was calculated as the percent of all γH2AX/53BP1 foci that colocalized with the specific BAC probe. The γH2AX/53BP1 positive foci in near-senescent BJ cells were distributed as follows: 43% of the cells had a single focus, 35% had two, 8% had three, 6% had four, and 8% had five or more foci. Correction for the number of colocalized foci per cell would result in a doubling of the % colocalization if expressed per cell instead of the data per focus as shown. (C) Presence of multiple short ends colocalizing with damage foci in single cells. The data in B have been reorganized to show the frequency with which a cell showing colocalization of one particular short telomere (e.g., 6pter) with a DNA damage focus also showed colocalization of other probes to DNA damage foci within the same cell. The short telomeres are shown in red.

End-associations Involving Short Telomeres

A high frequency of polyploidy and multiple chromosomal abnormalities have been reported as cells approach senescence (Saksela and Moorhead, 1963 Thompson and Holliday, 1975 Benn, 1976 Sherwood et al., 1988). However, previous reports were generally performed in embryonic lung fibroblasts. These cells undergo an oxidative crisis when grown in room oxygen (Atamna et al., 2000 Forsyth et al., 2003), and the inability of telomerase to immortalize these cells under ambient oxygen conditions in spite of elongating telomeres (Forsyth et al., 2003) strongly implicates global rather than just telomere-specific effects of oxidative damage. BJ foreskin fibroblasts have been shown to have much greater oxygen protective mechanisms than embryonic lung fibroblasts (Lorenz et al., 2001), and they immortalize directly after ectopic expression of telomerase (Bodnar et al., 1998). They thus provided an opportunity to examine the consequences of telomere shortening with fewer complications from other clastogenic processes. We confirmed that WI-38 embryonic lung fibroblasts exhibited many chromosomal abnormalities as they approached senescence (unpublished data). In stark contrast, in spite of the abundance of signal-free ends in metaphases from PD 84 BJ cells, the frequency of chromosomal abnormalities and end-associations in metaphase spreads from nearly senescent cells was too low to be easily quantitated. Tetraploid metaphases were also very rare (<1%). These cells were only three population doublings before senescence, and their growth rate had decreased from three doublings per week to one doubling per several weeks, so they clearly were in the period of culture where many cells were already senescent and only the longest-lived subpopulations were continuing to divide. This implies that most of the previously reported chromosomal abnormalities might reflect the combined results of oxidative crisis/cultured stress and telomere shortening rather than just the consequences of short telomeres. It also implies that in BJ fibroblasts, the presence of telomeres sufficiently short to appear in γH2AX foci is not sufficient to cause the appearance of gross chromosomal abnormalities.

The absence of abnormal metaphases suggested that either the short telomeres were inducing growth arrest before their formation or that the very first abnormality prevented the cells from dividing again so they dropped out of the mitotic population. We thus introduced factors to block cell-cycle checkpoint functions (human papilloma virus 16 proteins E6 and E7 (Scheffner et al., 1990 Werness et al., 1990 Barbosa et al., 1991) in order to obtain metaphases exhibiting the abnormalities due to short telomeres. HPV 16 E6+E7 does not activate telomerase in BJ cells but permits the bypass of senescence and confers an extended life span to the population.

Figure 3 compares the frequency of signal-free ends in 485 metaphases from E6+E7-expressing BJ fibroblasts at PD 88 with those observed in PD 84 parental BJ cells. There is a very close correspondence to the frequency of signal-free telomeres in the uninfected cells, indicating that ∼30 doublings in the presence of E6+E7 has not significantly altered the telomere-shortening rate or affected the specific chromosomes having the shortest telomeres. The few minor alterations in frequency that are present may reflect that at PD 88 the E6+E7 cells are still dividing vigorously and continue to represent the clonal diversity in the original population, whereas at PD 84 most clonal lineages have become senescent and only a few of the longest-lived clones are continuing to divide.

Figura 3. The same telomeres are short in normal BJ and BJ cells expressing E6+E7. BJ cells infected with a retrovirus expressing human papilloma virus 16 proteins E6+E7 at about PD 65 were analyzed for the presence of telomeres with signal-free ends at PD 88.5 using the same techniques as for BJ cells in Figure 1. The results of both analyses demonstrate that E6+E7 has neither affected the telomere shortening rate nor the telomeres showing signal-free ends in cells with abrogated cell-cycle checkpoints, because both cell types show the same frequencies and distribution.

The frequency of signal-free ends at the Xp/Yp telomere was 3% for both normal BJ at PD 84 and BJ with E6+E7 at PD 88. To determine the approximate sensitivity of detecting signal-free ends, we used STELA (Baird et al., 2003) to amplify individual Xp/Yp telomeres. One hundred seventy-seven individual bands (90 from BJ and 87 from BJ E6+ E7) were analyzed. After subtracting the 400 base pairs of subtelomeric sequences amplified with each product (Baird et al., 2003), the shortest five bands (3% of 177) contained <100 base pairs of C-strand telomeric sequences. Telomeres identified as signal-free thus had very few remaining telomeric repeats.

Telomere associations appeared in the presence of E6+E7 at approximately the same population doubling level as when senescence occurred in control cultures (Table 1). The frequency of end-associations at PD 84–91 is plotted in Figure 4 as a function of the percentage of signal-free ends for each telomere from Figure 3. Each end-association is plotted twice, i.e., an association between 20p and 21p is considered equivalent to one between 21p and 20p. The vast majority (94%) of the end-associations occurring at the time of M1 involved the 10 shortest telomeres. Forty-four percent of the associations occurred within members of this group, whereas most of the remainder (49%) occurred between,one of these 10 and other chromosomes. There is a wide distribution of end-associations, indicating that the events are polyclonal and do not represent the overgrowth of a cell with one particularly short telomere. This distribution demonstrates that the end-associations are not due to the “programming” of one or two “sentinel” telomeres that monitor divisions, but rather the cell is using the shortening of roughly 10% of its telomeres as a measure of replicative history.

Tabela 1. Frequency of end-associations involving the 10 shortest telomeres

M1 (senescence) occurred at approximately PD 85 in control cultures without E6+E7 and M2 (crisis) occurred at PD 103–105. At least 20 metaphases were scored at each population doubling level (PDL).

Figura 4. Chromosomal end-associations in BJ E6+E7 cells. The frequency of end-associations for specific telomeres is shown for BJ foreskin fibroblasts expressing E6+E7 at PD 84–91, the approximate time when M1 would have occurred in parallel cultures without E6+E7. The axes are arranged according to the frequency of signal-free ends per 100 metaphases shown in Figure 3. Each event is plotted twice, because an association between telomeres A and B is equivalent to an association between B and A. The dotted diagonal line reflects this line of symmetry. Almost all of the associations either involve short-short associations (darker gray box at the top left) or associations between the 10 shortest and other chromosomes (lighter gray boxes). There is no significant bias of one or a few specific ends. The distribution as plotted does not distinguish between homologues of the 22 autosomal chromosomes, so there are only 48 ends along each axis. If separated into homologues, the 10 shortest would represent 10 of 92 ends (see Figure 5).

Consistent with previous observations of the size heterogeneity of homologous chromosomes (Londono-Vallejo et al., 2001 Baird et al., 2003 der-Sarkissian et al., 2004), we found little correlation between the telomere lengths of the two parental chromosomes (e.g., metaphase spreads in which there was no telomeric FISH signal on one chromosome 8q exhibited good doublet signals on the other chromosome 8q). In some cases, the parental chromosomes could be distinguished by the presence of very different signals when hybridized to telomeric sequence variants (such as (TGAGGG)3 or (TCAGGG)3), which can be present in a polymorphic pattern at the base of the telomeres (Allshire et al., 1989 Baird et al., 2000). This confirmed that the signal-free ends were either on the maternal or paternal chromosome but not both (Figure 5, p = 0.0005). Consequently, the 10 shortest telomeres represent the 10 shortest among 92 rather than among 46 telomeres. The expected fraction of short-short associations by random chance is 5% (assuming 10/46 ends) or 1% (assuming 10/92 ends), very different from the 44% observed (p < 0.0001 by the one sample proportions test). The results in Figure 4 are thus highly significant.

Figura 5. Telomeric sequence variants distinguish parental chromosomes. (A) Telomeres were hybridized with probes for the telomeric repeat [(TTAGGG)3-FITC] or a Cy3-labeled sequence variant (TGAGGG)3 often found at the very base of the telomere. The top chromosome 8 shows a strong telomeric signal on the q arm but a weak variant repeat signal, whereas the lower chromosome 8q from the same cell exhibits no TTAGGG fluorescence (thus a signal-free end) but a strong sequence variant signal, thus allowing the parental homologues to be determined. (B) In cases where the parental homologues could be determined by polymorphisms in the amount of sequence variants, the signal-free ends were always present on one but not both parental telomeres. The probability of finding this pattern in 3 metaphases is 0.25, in 2 metaphases is 0.5, and for all 18 metaphases on 7 ends shown is 0.0005.

Telomere Associations during the Extended Lifespan

The specific chromosomes involved in end-associations were monitored as cells progressed beyond M1 until they reached crisis (Table 1). The predominance of end-association events involving the 10 shortest chromosomes continued for an additional 10–15 doublings, consistently representing ∼90% of all telomere associations. As the cells approached M2 (PD103–105) their relative abundance diminished slightly as other telomeric ends become sufficiently short to initiate additional events.


TELOMERE BINDING PROTEINS

Schematic Diagram of Telomeres Modeled after the Human Architecture.

The top of the panel shows the telomeric DNA with associated proteins in the t-loop confirmation. Upon shortening or during replication, unfolding of the t-loop allows the telomerase holoenzyme to access the ends and extend them if necessary, as shown in the bottom of the panel. Although plant homologs for many of these proteins have been identified in databases, a direct association with telomeres has yet to be demonstrated in most cases.

Schematic Diagram of Telomeres Modeled after the Human Architecture.

The top of the panel shows the telomeric DNA with associated proteins in the t-loop confirmation. Upon shortening or during replication, unfolding of the t-loop allows the telomerase holoenzyme to access the ends and extend them if necessary, as shown in the bottom of the panel. Although plant homologs for many of these proteins have been identified in databases, a direct association with telomeres has yet to be demonstrated in most cases.

In yeast, RAP1p was also found to bind the double-strand region of the telomere ( Berman et al., 1986 Longtine et al., 1989). The role of RAP1p was initially quite ambiguous because it was shown to function both in transcriptional regulation and in telomere biology. In the early 1990s, Titia de Lange's group used a biochemical approach to purify TRF1, a mammalian protein specifically associated with double-stranded telomeric DNA ( Zhong et al., 1992). The myb-like DNA binding motif that defines this class of molecules was later exploited to find additional telomere binding proteins ( Konig et al., 1996). Over the past few years, a variety of different activities from plant extracts have been reported to bind double-stranded telomeric DNA (reviewed in McKnight et al., 2002). However, no studies have been conducted to confirm the role of these proteins in vivo. Furthermore, because the Arabidopsis genome harbors >100 genes that encode proteins with myb-like domains ( Jin and Martin, 1999), a bioinformatics approach to finding functional homologs will be challenging.

Recently, a host of DNA repair proteins were shown to be associated with telomeres in humans and yeast (reviewed in Williams and Lustig, 2003). Of particular interest are proteins such as the Ku70/80 heterodimer and the MRX complex [Mre11/Rad50/Xrs2(Nbs1)] ( Figure 4). Both of these complexes are involved in double-strand break repair. Because a key function of telomeres is to prevent the natural ends of chromosomes from forming end-to-end associations, the presence of such machinery at telomeres was quite unexpected. Perhaps these DNA repair proteins contribute to genome stability by acting as sentinels to monitor the integrity of the telomere cap. Alternatively, DNA repair proteins may be recruited to telomeres because of their resemblance to double-stranded breaks, but the proteins are modified there so that they function to inhibit repair pathways, rather than activate them.


Cryo-EM Images Capture Key Enzyme Tied to Cancer, Aging

Posted on May 1st, 2018 by Dr. Francis Collins

Each time your cells divide, telomeres—complexes of specialized DNA sequences, RNA, and protein that protect the tips of your chromosomes—shorten just a bit. And, as the video shows, that shortening renders the genomic information on your chromosomes more vulnerable to changes that can drive cancer and other diseases of aging.

Consequently, over the last few decades, much research has focused on efforts to understand telomerase, a naturally occurring enzyme that helps to replace the bits of telomere lost during cell division. But there’s been a major hitch: until recently, scientists hadn’t been able to determine telomerase’s molecular structure in detail—a key step in figuring out exactly how the enzyme works. Now, thanks to better purification methods and an exciting technology called cryo-electron microscopy (cryo-EM), NIH-funded researchers and their colleagues have risen to the challenge to produce the most detailed view yet of human telomerase in its active form [1].

This structural biology advance is a critical step toward learning more about the role of telomerase in cancers, as well as genetic conditions linked to telomerase deficiencies. It’s also an important milestone in the quest for drugs targeting telomerase in different ways, perhaps to slow the growth of cancerous cells or to boost the proliferative capacity of life-giving adult stem cells.

One reason telomerase has been so difficult to study in humans is that the enzyme isn’t produced at detectable levels in the vast majority of our cells. To get around this problem, the team led by Eva Nogales and Kathleen Collins at the University of California, Berkeley, first coaxed human cells in the lab to produce larger quantities of active telomerase. They then used fluorescent microscopy, along with extensive knowledge of the enzyme’s biochemistry, to develop a multi-step purification process that yielded relatively homogenous samples of active telomerase.

The new study is also yet another remarkable example of how cryo-EM microscopy has opened up new realms of scientific possibility. That’s because, in comparison to other methods, cryo-EM enables researchers to solve complex macromolecular structures even when only tiny amounts of material are available. It can also produce detailed images of molecules, like telomerase, that are extremely flexible and hard to keep still while taking a picture of their structure.

As described in Natureza, the researchers used cryo-EM to capture the structure of human telomerase in unprecedented detail. Their images reveal two lobes, held together by a flexible RNA tether. One of those lobes contains the highly specialized core enzyme. It uses an internal RNA template as a guide to make the repetitive, telomeric DNA that’s added at the tips of chromosomes. The second lobe, consisting of a complex of RNA and RNA-binding proteins, plays important roles in keeping the complex stable and properly in place.

This new, more-detailed view helps to explain how mutations in particular genes may lead to telomerase-related health conditions, including bone marrow failure, as well as certain forms of anemia and pulmonary fibrosis. For example, it reveals that a genetic defect known to cause bone marrow failure affects an essential protein in a spot that’s especially critical for telomerase’s proper conformation and function.

This advance will also be a big help for designing therapies that encourage telomerase activity. For example, it could help to boost the success of bone marrow transplants by rejuvenating adult stem cells. It might also be possible to reinforce the immune systems of people with HIV infections. While telomerase-targeted treatments surely won’t stop people from growing old, new insights into this important enzyme will help to understand aging better, including why some people appear to age faster than others.

As remarkable as these new images are, the researchers aren’t yet satisfied. They’ll continue to refine them down to the minutest structural details. They say they’d also like to use cryo-EM to understand better how the complex attaches to chromosomes to extend telomeres. Each new advance in the level of atomic detail will not only make for amazing new videos, it will help to advance understanding of human biology in health, aging, and disease.

[1] Cryo-EM structure of substrate-bound human telomerase holoenzyme. Nguyen THD, Tam J, Wu RA, Greber BJ, Toso D, Nogales E, Collins K. Nature. 2018 April 25. [Epub ahead of publication]


Telomere Shortening and Human Disease

Dyskeratosis Congenita

Dyskeratosis congenita is a constitutional aplastic anemia predominantly manifested in the first two decades of life, characterized by bone marrow failure, a triad of mucocutaneous abnormalities (nail dystrophy, leukoplakia, and skin hyperpigmentation), and increased susceptibility to cancer. The most common cancers are head and neck squamous cell carcinomas, skin and anorectal cancer, and acute myeloid leukemia. 13 The risk for tongue cancer shows more than 1000-fold increase, and the risk for acute myeloid leukemia is increased almost 200 times. Dyskeratosis congenita patients also are at risk to develop myelodysplasia.

Dyskeratosis congenita is the prototypical disease caused by excessive telomere shortening. 14 Mutations in DKC1, which encodes the telomerase component dyskerin, are etiologic in X-linked dyskeratosis congenita. Autosomal forms of dyskeratosis congenita (recessive or dominant) are due to mutations in TERT, 15 , TERC, 16 , NHP2, 17 , NOP10 18 (the last two are proteins that associate with the telomerase complex and their mutations are found in autosomal recessive cases only), or TINF2. 19 These mutations dramatically reduce the function of the telomerase complex to extend telomeres or, in the case of TINF2, lead to inappropriate capping of telomeres. As telomerase is usually expressed at very low levels in healthy stem cells, heterozygous mutations in either TERT ou TERC suffice for telomerase deficiency by haploinsufficiency. All these mutations ultimately result in excessive telomere attrition and replicative senescence of the hematopoietic stem cells, which is clinically translated into marrow failure. In most patients with dyskeratosis congenita, telomeres of both granulocytes and lymphocytes are extremely short (usually varying from 3 to 5 kb long, as opposed to an expected average length of 7 to 8 kb in a 20-year-old healthy subject). 12 Since a handful of genes potentially mutate in dyskeratosis congenita and since some of these genes are relatively large, genetic sequencing may be cumbersome and expensive. Additionally, the mutated gene is yet to be identified in a proportion of dyskeratosis congenita patients.

Telomere length measurement, especially in lymphocytes, however, appears to be a good screening test to confirm the diagnosis of dyskeratosis congenita and to identify clinically healthy mutation carriers in families. 20 Telomere length measurement has important clinical implications in the selection of related donors for hematopoietic stem cell transplant. Several techniques measure telomeres: Southern blot, quantitative PCR (qPCR), and flow-FISH (a combination of flow cytometry and fluorescence in situ hybridization). However, the method that seems more accurate and reliable from the clinical perspective seems to be flow-FISH, in which telomere lengths in different cell types (granulocytes, lymphocytes) can be distinguished. 20 , 21

Aplastic Anemia

Most cases of acquired aplastic anemia are the consequence of an immune-mediated destruction of hematopoiesis, and a minority of patients with aplastic anemia has heterozygous mutations in genes encoding the telomerase components TERT ou TERC (5%–10% of cases) mutations in shelterin components are very rarely found in patients with aplastic anemia 22 and are predominantly found in pediatric cases. 23 These patients lack the classical clinical features of dyskeratosis congenita (mucocutaneous anomalies, lung fibrosis, esophageal stricture, short stature, etc), but a proportion of them have a familial history that can suggest the possibility of a telomerase mutation. The clinical history may vary from a relative with some signs of marrow deficiency (isolated thrombocytopenia, anemia unresponsive to B12 or iron therapy), myelodysplasia, aplastic anemia, or acute myeloid leukemia. Other patients may have a family history of severe liver disease or lung fibrosis, and the clinician should be attentive to this. 24 Again, in the setting of aplastic anemia, telomere length measurement may be useful to identify suitable sibling donors for stem cell transplant.

Most patients with aplastic anemia with telomerase mutations do not respond adequately to immunosuppressive therapy. 22 On the other hand, selection of suitable sibling donors for stem cell transplant must take into account the mutation status and telomere length of potential candidates. The majority of patients respond, at least transiently, to androgen therapy. Androgens activate telomerase activity in hematopoietic cells by its aromatization into estrogens and via the estrogen receptor pathway. 25 In a large series of patients undergoing immunosuppressive therapy (n = 183), telomere length of leukocytes at diagnosis did not predict clinical response at six months however, patients with shorter telomeres (mostly without any telomerase mutation) had a higher possibility of relapse, an increased risk to evolve to myelodysplasia (especially the most feared monosomy 7) and acute myeloid leukemia, and poorer overall survival in comparison to patients with longer telomeres. 26 Bone marrow cells of short-telomere aplastic patients also present increased chromosomal instability em vitro. Along with absolute reticulocyte and lymphocyte counts, 27 telomere length is likely to be critical in therapy decision making.

Pulmonary Fibrosis

Up to 20% of patients with dyskeratosis congenita eventually develop pulmonary fibrosis. 28 In fact, respiratory failure and liver cirrhosis are severe complications and causes of death after hematopoietic stem cell transplant for dyskeratosis congenita. The investigation of patients with familial idiopathic fibrosis led to the identification of telomerase gene mutations in 8% to 10% of familial cases. 29 , 30 In these families, most affected subjects present pulmonary fibrosis only, although some individuals also develop aplastic anemia. Of clinical importance, in most of these cases, there is a strong history of cigarette smoking among clinically affected patients. In sporadic pulmonary fibrosis, the frequency of telomerase mutations is much lower (approximately 1%). The age of onset of pulmonary disease usually is after the fifth decade of life in telomerase-mutant patients, as opposed to marrow failure, in which disease also may manifest at younger ages. The mechanism for fibrosis in these patients is elusive, but it has been suggested that short telomeres cause a deficiency in pneumocyte stem cells and loss of alveolar cells, and fibrosis appears as a secondary event.

Short Telomeres and Cancer

Patients with aplastic anemia carrying telomerase mutations have an increased risk of developing cancer, in particular acute myeloid leukemia. 13 A strong family history of myelodysplasia and myelodysplasia evolving to acute myeloid leukemia also is observed. 31 These observations led us to investigate cases of de novo acute myeloid leukemia. We implicated constitutional telomerase mutations in up to 8% of acute myeloid leukemia cases telomerase mutations correlated with chromosomal abnormalities, especially trisomy 8 and inv(16). 32 Constitutional telomerase deficiency may cause variable degrees of telomere shortening in hematopoietic stem cells due to short telomeres, these cells become prone to chromosomal instability (aneuploidy, breakage-fusion-bridges, translocations) and eventually, in the presence of other genetic and/or environmental factors, also more vulnerable to “second hits” and malignant transformation. In support of this hypothesis, we also have found that hematopoietic progenitor cells of aplastic anemia patients with short telomeres display increased chromosomal abnormalities em vitro, such as chromosomal breakage, aneuploidy, and end-to-end fusions. 26 These cells display chromosomal instability and are probably more likely to evolve to a clonal disorder. Additionally, other healthy hematopoietic stem and progenitor cells with short telomeres that effectively activate cell signaling via p53 and p21 undergo proliferation arrest and senescence. The result is the selection of abnormal, chromosomally unstable stem and progenitor cells in the bone marrow.

At the same time that TERT mutations were associated with acute myeloid leukemia, the TERT locus also was associated with a variety of other cancers using a radically different technical approach. A large genome-wide association study (3259 cases and 4159 controls) detected two polymorphisms in the TERT gene as risk factors for lung cancer. 33 Subsequent studies confirmed the association between the TERT locus and lung cancer. 34 Interestingly, an additional very large Icelandic genome-wide association study (over 30,000 cancer cases and 45,000 controls) linked the TERT locus to basal cell carcinoma, bladder cancer, prostate cancer, and lung cancer. 35 These association studies did not incriminate specific TERT polymorphisms as causative of cancers, but implicated the TERT locus as a highly significant genetic risk factor for cancer.

Additionally, telomere shortening has been observed in non-dysplastic mucosa surrounding premalignant or malignant lesions in ulcerative colitis. 36 Telomere shortening was not seen in the mucosa of patients with ulcerative colitis that did not progress to dysplasia or cancer. Shorter telomeres also have been associated with progression to adenocarcinoma in patients with Barrett’s esophagus. 37 Taken together, these studies, driven by different hypotheses, strongly implicate the telomerase locus as an important genetic risk factor in oncogenesis and leukemogenesis. Unfortunately, telomeres were not measured in genome-wide association studies. However, if the theoretical mechanism for telomerase mutations predisposing to acute myeloid leukemia is also applicable to other solid tumors, it is reasonable to speculate that shorter telomeres in different tissues also may contribute to chromosomal instability, which in the presence of other genetic and environmental factors (eg, smoking), may all contribute to tumorigenesis. This is an exciting area of active investigation.

Telomere Shortening and the Environment

Telomere shortening is not determined solely by telomerase mutations environmental factors may also modulate the rate of telomere erosion in humans. Physiologically, telomeres become shorter with age iatrogenically, telomeres may be shortened by intensive chemotherapy, such as in the setting of autologous hematopoietic stem cell transplant. 38 Patients with accelerated telomere shortening after autologous transplant are at higher risk of developing secondary myelodysplasia. Patients with excessive telomere erosion after allogeneic hematopoietic stem cell transplant also are more likely to develop graft-versus-host disease. 39 Cigarette smoking and psychological stress have also been shown to induce accelerated telomere attrition. 22 On the other hand, estrogen therapy may abrogate the rate of telomere loss. In one study, women taking hormone replacement therapy have longer telomeres than those not receiving any hormone. 40


How to Access TA-65

The TA Sciences Center is located in Manhattan, NY. The Patton Protocol with TA-65 costs approximately $2,500 for initial tests (including extensive blood work, telomere length measurements, and seven biomarkers of aging). The first six months of the protocol is approximately $6,725. Members of the Life Extension Foundation receive a 10% discount off of these prices. TA Sciences can be contacted at:

Toll Free: 888-360-8886 | Office: 212-588-8805 | Fax: 212-588-0058 | Web Site: www.tasciences.com


Telomere Biology and Human Phenotype

1) The relation between obesity and telomere shortening needs to be discussed more extensively.

It is known tha obesity associates with short telomeres due to inflammation.

It has also been shown that weight loss is associated to telomere lengthening in a positive correlation: the greater weight loss the greater telomere lengthening. ( Mol Genet Metab. 2016 Jun118(2):138-42. Telomere length elongation after weight loss intervention in obese adults. Carulli ) could you please discuss it)

2) it has been shown that short telomeres and/or telomerase mutations associate with hepatocarcinoma. Please could you discuss also this point.

3)The manuscript is well written even though the references need to be updated.

Thank you for your helpful comments. We have incorporated your comments and responded them below.

Dr Vimal Vasu (on behalf of all co-authors)

Response to Reviewer 1 Comments:

The relation between obesity and telomere shortening needs to be discussed more extensively. It is known that obesity associates with short telomeres due to inflammation. It has also been shown that weight loss is associated to telomere lengthening in a positive correlation: the greater weight loss the greater telomere lengthening (Mol Genet Metab. 2016 Jun118(2):138-42. Telomere length elongation after weight loss intervention in obese adults.Carulli). Could you please discuss it?

Thank you very much for drawing our attention to this research publication, which we were not aware of. We chose to deliberately keep the detail on the relationship between telomere length and obesity brief in order to remain succinct and also to maintain flow within the review. Nonetheless, in light of this comment, we have updated table 1 to incorporate this detail in the section related to obesity. Please see the following modification to the text and the inclusion of the recommended reference (81):

“Telomeres are known to be shortened in obese individuals. Obesity is linked to a state of chronic inflammation, with increased reactive oxygen species (ROS) production in adipose tissue in addition to presence of greatly increased systemic oxidative stress. Furthermore, telomere length is correlated with body mass index (BMI), with increased BMI resulting in higher blood volume, stimulating increased proliferation of blood cells and leading to telomere shortening. Interestingly, weight loss is positively correlated with telomere lengthening, and those with shortest telomere length at baseline benefit from the most pronounced rate of telomere lengthening following weight loss. A greater adherence to a Mediterranean diet is also associated with longer telomeres.”

It has been shown that short telomeres and/or telomerase mutations associate with hepatocarcinoma. Please could you discuss also this point?

Many thanks for this comment. We have updated the text in lines 294-295 and included a further two references that the reader may be referred to for further information (162,163). Once again, we chose to be deliberately brief on the association between telomere length and specific types of cancer in the interest of remaining concise. We have not discussed any other specific cancer in greater detail and therefore we felt that further discussion around the relationship between telomere length and hepatocarcinoma would disrupt the flow of the review.

The manuscript is well written even though the references need to be updated.

We are very pleased to hear that you believe the manuscript to be well written. Thank you very much for this comment. We appreciate that many of the references in the bibliography are dated, however we chose to include original references that cite the first discoveries relating to telomere biology e.g. work by Elizabeth Blackburn, James Watson and Leonard Hayflick. We did not find any specific instruction with regards to publication date of references in the author instructions and therefore we have included references that cite notable observations during the history of the field in addition to the very latest observations. Indeed 64 of our references have been published in the last 10 years. We hope that this is satisfactory to the editor.

In the review entitled «Telomere biology and human phenotype » the authors present the structure and function of human telomeres. Telomere homeostasis throughout a life-time is also addressed. Moreover the authors discuss the available evidence that shows that telomere shortening is related to human aging and the onset of age-related disease.

The review article is well written and it represents a significant contribution to the field. Nevertheless, I do have comments in order to improve the manuscript.

“In all mammals, telomeres are formed of a highly conserved, non-coding, hexameric (TTAGGG) tandem repeat DNA sequence ……”

It is now know that mammalian telomeres are transcribed into telomeric repeat–containing RNA (TERRA). Azzalin et al 2007, as a consequence, I suggest to the authors to change the sentence line 21

“ ….. and associated with specialised proteins collectively known as the Shelterin complex [1-3].”

To my point of view, the authors left out the non-Shelterin proteins present in the telosome. I suggest to the authors to modify the sentence in order to present all telomeric protein (Shelterin and the others) and to precise that they will focus only on the Shelterin in table1

“Table 1. The Shelterin complex: Characterisation of the proteins that make up the telosome [3,6]. ”

Similar comment: Telosome is not only composed by Shelterin. Table1 title should be changed as only Shelterin proteins are listed. References “[3,6]” could be completed for i.e: Denchi and Sfeir molecular cell biology 2016

Table1 Protein name

Shelterin name should be modified according to their official name and the commonly use name mentioned

Official full name telomeric repeat binding factor 1, TERF1, also known as TRF1

Official full name telomeric repeat binding factor 2,TERF2, also known as TRF2

Official full name TERF1 interacting nuclear factor 2, TINF2, also known as TIN2

Official full name shelterin complex subunit and telomerase recruitment factor, ACD, also known as TPP1

Official full name TERF2 interacting protein, TERF2IP, also known as RAP1

Table1 Interactions

TIN2 associates diretamente with TRF2 and TPP1 but not with POT1

“Thus, there are several mechanisms that result in telomere attrition following replication in proliferating cells and it is thought that the presence of a non-coding telomere sequence acts as a ‘buffering system’ to prevent the loss of crucial coding DNA”

To my point of view the notion of non-coding telomere sequence is not correct regarding TERRA presence. The sentence should be modified, references and comments should be added

“Despite the presence of these elongation mechanisms, telomere shortening is still observed following proliferation in most stem cells (with the exception of embryonic stem cells). This is because these mechanisms are increasingly reduced during differentiation and therefore they are insufficient to completely eradicate telomere loss.”

In these sentences maybe I do not understand the sentences, but to my point of view there is a problem between “in most stem cell” and “during differentiation”

References [16,17], I will add Shay and Wright molecular cell biology 2000

“….length in vivo in relation to chronological age.” I will add reference

Lines 115-116

“Moreover, a variety of studies have investigated the 115 relationship between telomere length and age-related disease.” I will add reference

“…consistent with the highly variable telomere length observed in embryos [30] and fetuses [33,34].”

I will add humano in the sentence “…. no humano embryos [30] and fetuses [33,34].”

I will modified the organization of this last part of the manuscript as follow:

4. Telomere length and biological aging

4.1.Telomere biology and premature aging disorders

4.2 Telomere length in age-related cardiometabolic and neurological disorders

4.3 Telomeres, tumorigenesis and cancer

Lines 168, 169, 180

in vitro, in vivo must be written in italics

“…associated with type II diabetes” I will add reference

“. [118,119]” I will add Chevret et al Blood 2014

Thank you for your helpful comments. We have incorporated your comments and responded them below.


Assista o vídeo: Envelhecimento, Treinamento Físico e Telômeros (Novembro 2021).